BBa_M1366 1 BBa_M1366 Gliadin (triticum aestivum) 2012-04-10T11:00:00Z 2015-05-08T01:13:56Z This sequence was backtranslated, optimized for E. coli and modified to remove illegal restriction sites from an aa sequence from triticum aestivum. it endodes the alpha subunit of gliadin. This sequence codes for gliadin, alpha subunit. It does not include any post-translational action. false false _768_ 0 10129 9 Not in stock false Some modifications were made to eliminate illegal restriction sites. false Eric B Anderson annotation2172110 1 Start range2172110 1 1 3 annotation2172112 1 Coding Sequence range2172112 1 1 889 annotation2172111 1 Stop range2172111 1 889 891 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_M1365 1 BBa_M1365 Alpha Gliadin Complete 2012-04-23T11:00:00Z 2015-05-08T01:13:56Z See info of basic part (BBa_M1366) Alpha Gliadin conding sequence with constitutive promoter and RBS, plus double terminator false false _768_ 0 10129 9 Not in stock false Added Constitutive promoter & RBS and double terminator false Eric B Anderson component2173204 1 BBa_M1366 component2173207 1 BBa_B0012 component2173205 1 BBa_B0010 component2173197 1 BBa_J23100 component2173199 1 BBa_B0030 annotation2173205 1 BBa_B0010 range2173205 1 964 1043 annotation2173199 1 BBa_B0030 range2173199 1 44 58 annotation2173207 1 BBa_B0012 range2173207 1 1052 1092 annotation2173204 1 BBa_M1366 range2173204 1 65 955 annotation2173197 1 BBa_J23100 range2173197 1 1 35 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_M1366_sequence 1 atgaaaacgttcctgatcctggcactgttagctatcgttgcaacaacagctacaaccgcagtacgtgttccggtaccccaacctcaaccgcaaaatccgagtcaaccgcagccccagcgccaggttccgctcgtccaacagcaacaattccctggccagcagcagcagtttcccccgcagcagccttatccccagccccaaccttttccgagtcagcagccgtacctgcaattacagccgttcccacagccgcagccattccccccgcagttgccgtacccacaaccgccgcctttttcaccccagcaaccatacccgcagcctcaacctcaatacccccagccgcagcaacccattagtcaacagcaggcccaacaacagcagcaacagcagcagcaacaacaacaacagcagcaacagcagcagatcctgccccaaatcttacagcagcaactgataccatgtagagatgtcgtgttacagcagcacaacatcgcccatgccagatcacaggtcttacagcaatcaacctatcagccattacaacagctttgttgccagcagctttggcaaatccctgaacaatcacgctgccaggccatccataatgtagtgcacgccataatcctgcaccagcaacaacagcaacagcaaccgagcagccaggttagtttgcagcagccgcagcagcagtatccctcaggccaaggttttttccagcctagtcaacagaacccgcaggctcagggttcagtacagccacagcaactgccgcagttcgaggaaatccgtaacctggctttacagaccctgccgagaatgtgcaatgtgtatattcccccgtactgctcgacgacgaccgcaccctttggaatttttgggacaaattga BBa_B0030_sequence 1 attaaagaggagaaa BBa_M1365_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagatgaaaacgttcctgatcctggcactgttagctatcgttgcaacaacagctacaaccgcagtacgtgttccggtaccccaacctcaaccgcaaaatccgagtcaaccgcagccccagcgccaggttccgctcgtccaacagcaacaattccctggccagcagcagcagtttcccccgcagcagccttatccccagccccaaccttttccgagtcagcagccgtacctgcaattacagccgttcccacagccgcagccattccccccgcagttgccgtacccacaaccgccgcctttttcaccccagcaaccatacccgcagcctcaacctcaatacccccagccgcagcaacccattagtcaacagcaggcccaacaacagcagcaacagcagcagcaacaacaacaacagcagcaacagcagcagatcctgccccaaatcttacagcagcaactgataccatgtagagatgtcgtgttacagcagcacaacatcgcccatgccagatcacaggtcttacagcaatcaacctatcagccattacaacagctttgttgccagcagctttggcaaatccctgaacaatcacgctgccaggccatccataatgtagtgcacgccataatcctgcaccagcaacaacagcaacagcaaccgagcagccaggttagtttgcagcagccgcagcagcagtatccctcaggccaaggttttttccagcctagtcaacagaacccgcaggctcagggttcagtacagccacagcaactgccgcagttcgaggaaatccgtaacctggctttacagaccctgccgagaatgtgcaatgtgtatattcccccgtactgctcgacgacgaccgcaccctttggaatttttgggacaaattgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z