BBa_M1370 1 BBa_M1370 gliadin complete 2012-03-27T11:00:00Z 2015-05-08T01:13:56Z Triticum aestivum Coding sequence, promoter, RBS and terminators for gliadin from Triticum aestivum. false false _831_ 0 10129 9 Not in stock false Stop codon was added in silico. false Eric B Anderson component2171516 1 BBa_J61122 component2171523 1 BBa_B0010 component2171518 1 BBa_B0040 component2171515 1 BBa_J23100 component2171522 1 BBa_M1369 component2171525 1 BBa_B0012 annotation2171523 1 BBa_B0010 range2171523 1 1039 1118 annotation2171516 1 BBa_J61122 range2171516 1 44 55 annotation2171518 1 BBa_B0040 range2171518 1 64 133 annotation2171525 1 BBa_B0012 range2171525 1 1127 1167 annotation2171522 1 BBa_M1369 range2171522 1 140 1030 annotation2171515 1 BBa_J23100 range2171515 1 1 35 BBa_B0040 1 spacer Spacer.1 (generic) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Randomly generated and optimized for several parameters (see Design notes). Released HQ 2013 Generic spacer for ensuring a 70 bp distance between the end of the suffix of the BioBrick part containing the double terminator and the prefix of the BioBrick part containing the promoter of the new gene. Please, use the AlignX function of Vector NT to check for homology with the components in your plasmid before using this spacer.</P> false false _1_ 0 24 7 In stock false <P> <P><p>The size of the spacer was choosed to meet the minimum length of a sequence that can be queried using the BLAST search engine. However, subsequences of it can be used to design shorter spacers. The sequence was selected from many more sequences randomly generated using the <a href="http://www.lifesci.ucsb.edu/~maduro/random.htm">Random DNA Generator </a>engine; the GC% parameter used as input was 50%. The sequences were selected based on the following constraints listed in their order of importance: the absence of any putative promoter regions, a low degree of homology with the Elowitz plasmid (whose components are widely used in our designs), no homology with other <em>E.coli</em> sequences as shown by BLASTN search results and the presence of a number of TAA stop codons. The second constraint was the most stringent leading to the elimination of most sequences. </p> <p> DE made the following changes to the original sequence in order to add stop codons in the -3 frame and more in the +2 frame (note, not all of these stop codons are UAA. Thus, if used in an organism that inserts an amino acid @ UGA or UAG the obvious will occur):<br> T->A @ 85<br> T->A @ 42<br> C->T @ 79<br> A->T @ 64<br> A->T @ 31<br> T->A @ 34<br> C->A @ 37<br> Also, note that the above changes further reduce (the already very weak) homology to current NCBI-stored sequences.<br> </p> <P>In the process of selecting the best sequence it appeared that a good alternative sequence for a spacer would be: AGGTTCTGATATGTAACTGTGCCCAATGTCGTTAGTGACGCATACCTCTTAAGAGGCCACTGTCCTAACA. The sequence contains no putative promoters and shows moderate homology with the 5' end of the Ampicillin resistance gene. However a strong promoter sequence starts 12 bp downstream of this sequence, and therefore the sequence presented above was preferred. </p><P> The sequence is compatible (does not show significant homology) with the components in the Elowitz repressilator plasmid. true Vinay S. Mahajan, Brian Chow, Peter Carr annotation1721 1 Spacer-1 range1721 1 1 70 annotation7030 1 BBa_B0040 range7030 1 1 70 BBa_J61122 1 BBa_J61122 Ribosome Binding Site Family Member 2007-04-24T11:00:00Z 2015-08-31T01:59:49Z N/A {{JCA_Arkin_RBSFamily}} false false _95_ 0 483 95 It's complicated false N/A false John Anderson BBa_M1369 1 BBa_M1369 Gliadin (wheat) 2012-03-27T11:00:00Z 2015-05-08T01:13:56Z NCBI search for gliadin turns up an aa sequence determined by Reeves, C.D. and Okita, T.W. from Triticum aestivum. Codes for a gliadin subunit (as found in the protein gluten). false false _768_ 0 10129 9 Not in stock false DNA sequence determined by back translation to E. coli using DNA 2.0 Gene Designer. false Eric B Anderson annotation2171457 1 Coding range2171457 1 4 888 annotation2171456 1 Stop codon (added in silico) range2171456 1 889 891 annotation2171455 1 Start codon range2171455 1 1 3 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0040_sequence 1 aggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaaca BBa_M1370_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagagaggagctactagagaggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaacatactagatgaaaacgttcctgatcctggcactgttagctatcgttgcaacaacagctacaaccgcagtacgtgttccggtaccccaacctcaaccgcaaaatccgagtcaaccgcagccccagcgccaggttccgctcgtccaacagcaacaattccctggccagcagcagcagtttcccccgcagcagccttatccccagccccaaccttttccgagtcagcagccgtacctgcaattacagccgttcccacagccgcagccattccccccgcagttgccgtacccacaaccgccgcctttttcaccccagcaaccatacccgcagcctcaacctcaatacccccagccgcagcaacccattagtcaacagcaggcccaacaacagcagcaacagcagcagcaacaacaacaacagcagcaacagcagcagatcctgccccaaatcctgcagcagcaactgataccatgtagagatgtcgtgctgcagcagcacaacatcgcccatgccagatcacaggtcttacagcaatcaacctatcagccattacaacagctttgttgccagcagctttggcaaatccctgaacaatcacgctgccaggccatccataatgtagtgcacgccataatcctgcaccagcaacaacagcaacagcaaccgagcagccaggttagtttgcagcagccgcagcagcagtatccctcaggccaaggttttttccagcctagtcaacagaacccgcaggctcagggttcagtacagccacagcaactgccgcagttcgaggaaatccgtaacctggctttacagaccctgccgagaatgtgcaatgtgtatattcccccgtactgctcgacgacgaccgcaccctttggaatttttgggacaaattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_M1369_sequence 1 atgaaaacgttcctgatcctggcactgttagctatcgttgcaacaacagctacaaccgcagtacgtgttccggtaccccaacctcaaccgcaaaatccgagtcaaccgcagccccagcgccaggttccgctcgtccaacagcaacaattccctggccagcagcagcagtttcccccgcagcagccttatccccagccccaaccttttccgagtcagcagccgtacctgcaattacagccgttcccacagccgcagccattccccccgcagttgccgtacccacaaccgccgcctttttcaccccagcaaccatacccgcagcctcaacctcaatacccccagccgcagcaacccattagtcaacagcaggcccaacaacagcagcaacagcagcagcaacaacaacaacagcagcaacagcagcagatcctgccccaaatcctgcagcagcaactgataccatgtagagatgtcgtgctgcagcagcacaacatcgcccatgccagatcacaggtcttacagcaatcaacctatcagccattacaacagctttgttgccagcagctttggcaaatccctgaacaatcacgctgccaggccatccataatgtagtgcacgccataatcctgcaccagcaacaacagcaacagcaaccgagcagccaggttagtttgcagcagccgcagcagcagtatccctcaggccaaggttttttccagcctagtcaacagaacccgcaggctcagggttcagtacagccacagcaactgccgcagttcgaggaaatccgtaacctggctttacagaccctgccgagaatgtgcaatgtgtatattcccccgtactgctcgacgacgaccgcaccctttggaatttttgggacaaattaa BBa_J61122_sequence 1 aaagagaggagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z