BBa_M1521 1 BBa_M1521 Thermal Hysteresis (Antifreeze) Protein (variant YL3) 2012-04-10T11:00:00Z 2015-05-08T01:13:56Z This part comes from Tenebrio molitor. Amino acid sequences for four variants are found in a paper in Nature entitled, "Hyperactive antifreeze protein from beetles" (Graham et al., 1997). This is a thermal hysteresis (antifreeze) protein. It has up to 100 times the specific activity of fish antifreeze proteins. There are four variants of the protein (YL1-4). This is variant YL3. false false _768_ 0 12287 9 Not in stock false The codons were optimized to be used in E. coli. false Brian Smith annotation2172665 1 Coding Sequence range2172665 1 1 372 annotation2172664 1 Translation Start range2172664 1 1 3 BBa_M1521_sequence 1 atggcctttaaaacatgcggatttagtaaaaaatggttaatcatagccgttattgtgatgtgcttatgtacagaatgctattgccagtgcacaggaggtgctgattgtaccagttgcaccgctgcctgcacgggctgcggctcttgtcccaatgctcatacgtgtacagattcaaaaaattgtgttcgtgcagaaacctgtacagattccgaaaattgcgtgaaagcccatacttgtacgggttcccgcaattgcaataccgcaatgacgtgtacaaactcgaaagactgctttgaagcaaaaacctgtaccgattccaccaattgttataaggcaaccgcgtgtactaattctaccgggtgtccaggacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z