BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_M0051 1 BBa_M0051 AANDENYNYADAS. (Fast) SsrA degradation tag. 2007-12-05T12:00:00Z 2015-05-08T01:13:51Z This variation of the SsrA tag was studied by McGinness, Baker, Sauer. 2006. Mol. Cell. 22:701. This sequence codes for the amino acid sequence AANDENYNYADAS, a variation of the WT SsrA tag sequence, which, when fused to the C-terminal of proteins, will make the protein susceptible to fast degradation through SspB-mediated binding to the ClpX protease. The following rates of degradation of this tag are pulled from the corresponding references below: ~2 Vmax/ [Clpx6] min-1 from (1). See the following references for further information on degradation rates and mechanisms of this tag: (1)McGinness, Baker, Sauer. 2006. Mol. Cell. 22:701. (2)Flynn et al 2003. Mol. Cell. 11: 671. Flynn et al. 2001. PNAS 98(19): 10584. Anderson et al 1998. App. Env. Microbiol. 64(6):2240. false false _11_ 0 2398 11 Not in stock false C-terminal tag. Degradation rate is fast. Variations of this sequence yield different degradation rates(see Parts BBa_M0050, BBa_M0052, BBa_M0053). Sequence derived from reverse translation of AANDENYNYADAS sequence using codon usage optimized for E. coli. Three C-terminal aa's (DAS in this case) are necessary and sufficient for ClpX binding and degradation. Upstream aa sequence serves as a binding site for SspB, which guides rapid binding to ClpX. See sources on the main part page for further information about the mechanism of the system. NOTE: this sequence has only the amino acid sequence for the tag and bears NO STOP CODONS, so be sure to inlclude them if you use this sequence. false Felix Moser annotation1958881 1 AANDENYNYADAS SsrA deg. tag range1958881 1 1 39 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_M1630 1 BBa_M1630 mioC activated tet R +terminator 2013-04-14T11:00:00Z 2015-05-08T01:13:57Z combination Biobrick tet R coding sequence combined with mioC promoter to allow production of tet R protein during cell replication. false false _768_ 0 17020 9 Not in stock false standard ten compatible false kun zhang component2215789 1 BBa_I723020 component2215801 1 BBa_M0051 component2215791 1 BBa_R0040 component2215809 1 BBa_J61020 component2215808 1 BBa_B0015 component2215799 1 BBa_K313002 component2215797 1 BBa_B0030 component2215790 1 BBa_J61020 annotation2215789 1 BBa_I723020 range2215789 1 1 320 annotation2215797 1 BBa_B0030 range2215797 1 433 447 annotation2215799 1 BBa_K313002 range2215799 1 454 1725 annotation2215809 1 BBa_J61020 range2215809 1 1918 1951 annotation2215790 1 BBa_J61020 range2215790 1 329 362 annotation2215808 1 BBa_B0015 range2215808 1 1781 1909 annotation2215791 1 BBa_R0040 range2215791 1 371 424 annotation2215801 1 BBa_M0051 range2215801 1 1734 1772 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J61020 1 FRT [FRT] 2006-09-20T11:00:00Z 2015-08-31T02:02:59Z <tt> Extend ca1010F/R (73 bp, EcoRI/SpeI)<br> Sub into pSB1A2-I13522 (EcoRI/SpeI)<br> Product is pSB1A2-Bca1010<br> ---- ca1010F Forward (universal biobrick) EcoRI for FRT<br> GGACTgaattcgcggccgcttctagag<br> ca1010R Reverse SpeI oligo for FRT<br> cctatactagtagaagttcctattctctaAaaagtataggaacttcctctagaagcggccgcg<br> </tt> Site for recombination by flp recombinase. Genes flanked by FRT sites (oriented in the same direction) in the genome can be excised with the introduction of flp recombinase-expressing helper plasmid pCP20. Note that the original FRT sequence contained an XbaI site that has been removed with a point mutation for compatibility with standard assembly. See Datsenko and Wanner for details of its use in markerless knockouts and knockins. false false _95_ 0 483 95 It's complicated false N/A false John Anderson BBa_K313002 1 BBa_K313002 flpe DNA recombinase 2010-10-13T11:00:00Z 2015-05-08T01:11:54Z E.coli EL250 strain Flpe is a site-specific DNA recombinase that that recognizes FRT sequence. Flpe was derived from yeaset site-specific DNA recombinase Flp. (Buchholz, et al.,Improved properties of FLP recombinase evolved by cycling mutagenesis. Nature. Biotechnology, 16:657-662 ( 1998 )) It's internal EcoRI and SpeI site has been removed using site-directed mutagenesis. false false _433_ 0 5929 9 It's complicated false It's internal EcoRI and SpeI site has been removed using site-directed mutagenesis. false Kohaku So, Takashi Hiroi, Megumi Iseki, Mami Nakatake, Ryosuke Kamei, Ryo Kariyazono BBa_I723020 1 Pu Pu 2007-10-24T11:00:00Z 2015-08-31T04:07:54Z [Christine/Maia] This is the promoter activated by the transcriptional regulator XylR (BBa_I723136) in response to detection of environmental xylene. false false _126_ 0 2140 9 It's complicated false [Christine/Maia] true Scott Ramsay annotation1955192 1 Pu range1955192 1 1 320 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_I723020_sequence 1 cccgggaaagcgcgatgaaccttttttatcgctgccttgatcaaatcgacaggtggttatgcgcgattgatgatttgctcaaatacagccagcgtgctgtagattttctctcataccccccctttcttttttacaaagaaaatcaataatttagatgaaataaggggatcggtataagcaatggcatggcggttgctagctatacgagacttaaaataaaaatagtggtgacccttcaatgttgtattttctcaactctgttcagattggttgctttcgccatgtatatcctcaaagcgggccagccgtagccgttacgc BBa_B0030_sequence 1 attaaagaggagaaa BBa_J61020_sequence 1 gaagttcctatactttttagagaataggaacttc BBa_M1630_sequence 1 cccgggaaagcgcgatgaaccttttttatcgctgccttgatcaaatcgacaggtggttatgcgcgattgatgatttgctcaaatacagccagcgtgctgtagattttctctcataccccccctttcttttttacaaagaaaatcaataatttagatgaaataaggggatcggtataagcaatggcatggcggttgctagctatacgagacttaaaataaaaatagtggtgacccttcaatgttgtattttctcaactctgttcagattggttgctttcgccatgtatatcctcaaagcgggccagccgtagccgttacgctactagaggaagttcctatactttttagagaataggaacttctactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagattaaagaggagaaatactagatgagccagtttggcatattatgtaaaacaccacctaaggtcctggttcgtcagtttgtggaaaggtttgaaagaccttcaggggaaaaaatagcatcatgtgctgctgaactaacctatttatgttggatgattactcataacggaacagcaatcaagagagccacattcatgagctataatactatcataagcaattcgctgagtttcgatattgtcaacaaatcactccagtttaaatacaagacgcaaaaagcaacaattctggaagcctcattaaagaaattaattcctgcttgggaatttacaattattccttacaatggacaaaaacatcaatctgatatcactgatattgtaagtagtttgcaattacagttcgaatcatcggaagaagcagataagggaaatagccacagtaaaaaaatgcttaaagcacttctaagtgagggtgaaagcatctgggagatcactgagaaaatactaaattcgtttgagtatacctcgagatttacaaaaacaaaaactttataccaattcctcttcctagctactttcatcaattgtggaagattcagcgatattaagaacgttgatccgaaatcatttaaattagtccaaaataagtatctgggagtaataatccagtgtttagtgacagagacaaagacaagcgttagtaggcacatatacttctttagcgcaaggggtaggatcgatccacttgtatatttggatgaatttttgagaaattctgaaccagtcctaaaacgagtaaataggaccggcaattcttcaagcaacaaacaggaataccaattattaaaagataacttagtcagatcgtacaacaaggctttgaagaaaaatgcgccttatccaatctttgctataaagaatggcccaaaatctcacattggaagacatttgatgacctcatttctgtcaatgaagggcctaacggagttgactaatgttgtgggaaattggagcgataagcgtgcttctgccgtggccaggacaacgtatactcatcagataacagcaatacctgatcactacttcgcgctagtttctcggtactatgcatatgatccaatatcaaaggaaatgatagcattgaaggatgagactaatccaattgaggagtggcagcatatagaacagctaaagggtagtgctgaaggaagcatacgataccccgcatggaatgggataatatcacaggaggtactagactacctttcatcctacataaatagacgcatataatactagaggctgctaacgacgaaaactacaactacgctgacgcttcttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagaggaagttcctatactttttagagaataggaacttc BBa_M0051_sequence 1 gctgctaacgacgaaaactacaactacgctgacgcttct BBa_K313002_sequence 1 atgagccagtttggcatattatgtaaaacaccacctaaggtcctggttcgtcagtttgtggaaaggtttgaaagaccttcaggggaaaaaatagcatcatgtgctgctgaactaacctatttatgttggatgattactcataacggaacagcaatcaagagagccacattcatgagctataatactatcataagcaattcgctgagtttcgatattgtcaacaaatcactccagtttaaatacaagacgcaaaaagcaacaattctggaagcctcattaaagaaattaattcctgcttgggaatttacaattattccttacaatggacaaaaacatcaatctgatatcactgatattgtaagtagtttgcaattacagttcgaatcatcggaagaagcagataagggaaatagccacagtaaaaaaatgcttaaagcacttctaagtgagggtgaaagcatctgggagatcactgagaaaatactaaattcgtttgagtatacctcgagatttacaaaaacaaaaactttataccaattcctcttcctagctactttcatcaattgtggaagattcagcgatattaagaacgttgatccgaaatcatttaaattagtccaaaataagtatctgggagtaataatccagtgtttagtgacagagacaaagacaagcgttagtaggcacatatacttctttagcgcaaggggtaggatcgatccacttgtatatttggatgaatttttgagaaattctgaaccagtcctaaaacgagtaaataggaccggcaattcttcaagcaacaaacaggaataccaattattaaaagataacttagtcagatcgtacaacaaggctttgaagaaaaatgcgccttatccaatctttgctataaagaatggcccaaaatctcacattggaagacatttgatgacctcatttctgtcaatgaagggcctaacggagttgactaatgttgtgggaaattggagcgataagcgtgcttctgccgtggccaggacaacgtatactcatcagataacagcaatacctgatcactacttcgcgctagtttctcggtactatgcatatgatccaatatcaaaggaaatgatagcattgaaggatgagactaatccaattgaggagtggcagcatatagaacagctaaagggtagtgctgaaggaagcatacgataccccgcatggaatgggataatatcacaggaggtactagactacctttcatcctacataaatagacgcatataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z