BBa_M1634 1 BBa_M1634 Promoter of narGHJI 2013-04-19T11:00:00Z 2015-05-08T01:13:57Z Promoter sequence requirements for Fnr-dependent activation of transcription of the narGHJI operon Turn on gene expression in anaerobic conditions false false _768_ 0 16141 9 Not in stock false Nothing false Bo Zhao BBa_M1634_sequence 1 tccccatcactcttgatcgttatcaattcccacgctgtttcagagcgttaccttgcccttaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z