BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_M1658 1 BBa_M1658 Lung Cancer Biosensor 2013-04-02T11:00:00Z 2015-05-08T01:13:57Z Human being Group 3 false false _768_ 0 16148 9 Not in stock false Promoter, RBS, Histag, Coding false Guevara Che Nyendu component2214599 1 BBa_M1654 component2214591 1 BBa_J61100 component2214595 1 BBa_K844000 component2214600 1 BBa_B0012 component2214590 1 BBa_I712074 annotation2214590 1 BBa_I712074 range2214590 1 1 46 annotation2214599 1 BBa_M1654 range2214599 1 117 461 annotation2214591 1 BBa_J61100 range2214591 1 55 66 annotation2214600 1 BBa_B0012 range2214600 1 470 510 annotation2214595 1 BBa_K844000 range2214595 1 75 110 BBa_K844000 1 BBa_K844000 10x-Histidine (10x-His) Tag with double stop codon (TAATAA) 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Constructed through oligonucleotide annealing Released HQ 2013 10x-Histidine tag with double stop codon TAATAA to allow for better extraction of tagged products and protein termination in a single part. false false _1104_ 0 9404 9 In stock true none false Kathleen Miller annotation2206609 1 Stop range2206609 1 34 36 annotation2206608 1 Stop range2206608 1 31 33 annotation2206607 1 10x-Histidine Tag range2206607 1 1 30 BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_M1654 1 BBa_M1654 S100 calcium biomarker 2013-03-31T11:00:00Z 2015-05-08T01:13:57Z homo sapien Homo sapiens S100 calcium binding protein A9 (S100A9), mRNA, biomarker false false _768_ 0 16144 9 Not in stock false codon optimization was done and restriction enzymes were removed false whitney morgan annotation2214565 1 cds range2214565 1 4 342 annotation2214564 1 stop range2214564 1 343 345 annotation2214563 1 start range2214563 1 1 3 BBa_J61100_sequence 1 aaagaggggaca BBa_M1654_sequence 1 atgacctgcaaaatgagccaactagaacgtaacattgagacgattatcaatacctttcatcagtattcagtgaaactggggcatccggataccctcaaccaaggcgagtttaaggaactggtaaggaaagacctgcaaaactttcttaaaaaagaaaataaaaatgaaaaagtcattgaacatattatggaggatttggataccaatgcagacaaacaactgtcttttgaagagttcattatgctcatggcgcgtctgacgtgggcgtctcatgaaaagatgcacgaaggtgatgaaggtccgggacaccaccacaagccggggctgggggaaggaactccctag BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca BBa_K844000_sequence 1 catcatcaccatcaccaccatcatcaccattaataa BBa_M1658_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagaaagaggggacatactagagcatcatcaccatcaccaccatcatcaccattaataatactagatgacctgcaaaatgagccaactagaacgtaacattgagacgattatcaatacctttcatcagtattcagtgaaactggggcatccggataccctcaaccaaggcgagtttaaggaactggtaaggaaagacctgcaaaactttcttaaaaaagaaaataaaaatgaaaaagtcattgaacatattatggaggatttggataccaatgcagacaaacaactgtcttttgaagagttcattatgctcatggcgcgtctgacgtgggcgtctcatgaaaagatgcacgaaggtgatgaaggtccgggacaccaccacaagccggggctgggggaaggaactccctagtactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z