BBa_J61101 1 BBa_J61101 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A fix false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_M1652 1 BBa_M1652 CXC chemokine BRAK mRNA 2013-03-25T12:00:00Z 2015-05-08T01:13:57Z Human source Anti-marker protein false false _768_ 0 16132 9 Not in stock false None known currently false Howard Cordingley annotation2214558 1 stop range2214558 1 298 300 annotation2214559 1 CXC range2214559 1 4 297 annotation2214557 1 start range2214557 1 1 3 BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_M1654 1 BBa_M1654 S100 calcium biomarker 2013-03-31T11:00:00Z 2015-05-08T01:13:57Z homo sapien Homo sapiens S100 calcium binding protein A9 (S100A9), mRNA, biomarker false false _768_ 0 16144 9 Not in stock false codon optimization was done and restriction enzymes were removed false whitney morgan annotation2214565 1 cds range2214565 1 4 342 annotation2214563 1 start range2214563 1 1 3 annotation2214564 1 stop range2214564 1 343 345 BBa_K844000 1 BBa_K844000 10x-Histidine (10x-His) Tag with double stop codon (TAATAA) 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Constructed through oligonucleotide annealing Released HQ 2013 10x-Histidine tag with double stop codon TAATAA to allow for better extraction of tagged products and protein termination in a single part. false false _1104_ 0 9404 9 In stock true none false Kathleen Miller annotation2206609 1 Stop range2206609 1 34 36 annotation2206607 1 10x-Histidine Tag range2206607 1 1 30 annotation2206608 1 Stop range2206608 1 31 33 BBa_M1661 1 BBa_M1661 composite part for 1652 1654 2013-04-16T11:00:00Z 2015-05-08T01:13:57Z Parts 1652 and 1654 composite part for coding of cxc chemokine marker and s100 calcium biomarker false false _768_ 0 16364 9 Not in stock false Add the restriction enzyme false Pratima labroo component2215176 1 BBa_B0011 component2215178 1 BBa_I712074 component2215172 1 BBa_B0012 component2215183 1 BBa_K844000 component2215188 1 BBa_B0012 component2215179 1 BBa_J61101 component2215163 1 BBa_J61101 component2215187 1 BBa_M1654 component2215162 1 BBa_I712074 component2215171 1 BBa_M1652 component2215167 1 BBa_K844000 annotation2215179 1 BBa_J61101 range2215179 1 582 593 annotation2215171 1 BBa_M1652 range2215171 1 117 416 annotation2215183 1 BBa_K844000 range2215183 1 602 637 annotation2215187 1 BBa_M1654 range2215187 1 644 988 annotation2215188 1 BBa_B0012 range2215188 1 997 1037 annotation2215176 1 BBa_B0011 range2215176 1 474 519 annotation2215172 1 BBa_B0012 range2215172 1 425 465 annotation2215162 1 BBa_I712074 range2215162 1 1 46 annotation2215167 1 BBa_K844000 range2215167 1 75 110 annotation2215163 1 BBa_J61101 range2215163 1 55 66 annotation2215178 1 BBa_I712074 range2215178 1 528 573 BBa_J61101_sequence 1 aaagacaggacc BBa_M1654_sequence 1 atgacctgcaaaatgagccaactagaacgtaacattgagacgattatcaatacctttcatcagtattcagtgaaactggggcatccggataccctcaaccaaggcgagtttaaggaactggtaaggaaagacctgcaaaactttcttaaaaaagaaaataaaaatgaaaaagtcattgaacatattatggaggatttggataccaatgcagacaaacaactgtcttttgaagagttcattatgctcatggcgcgtctgacgtgggcgtctcatgaaaagatgcacgaaggtgatgaaggtccgggacaccaccacaagccggggctgggggaaggaactccctag BBa_M1661_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagaaagacaggacctactagagcatcatcaccatcaccaccatcatcaccattaataatactagatgcgtctgctggctgcggcactgttactgctgctgttggcgttgtataccgctcgcgttgatggcagtaaatgtaaatgttcacgcaaaggtccgaaaattcgctactctgatgtgaagaaactggaaatgaaaccgaaatatccgcactgtgaagaaaaaatggttatcatcaccacgaaaagcgttagccggtatcgcgggcaggaacactgcttgcatccgaaactccagtccaccaaacgctttatcaagtggtataatgcttggaatgaaaaaagacgcgtgtacgaggagtgatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagtaatacgactcactatagggaatacaagctacttgttctttttgcatactagagaaagacaggacctactagagcatcatcaccatcaccaccatcatcaccattaataatactagatgacctgcaaaatgagccaactagaacgtaacattgagacgattatcaatacctttcatcagtattcagtgaaactggggcatccggataccctcaaccaaggcgagtttaaggaactggtaaggaaagacctgcaaaactttcttaaaaaagaaaataaaaatgaaaaagtcattgaacatattatggaggatttggataccaatgcagacaaacaactgtcttttgaagagttcattatgctcatggcgcgtctgacgtgggcgtctcatgaaaagatgcacgaaggtgatgaaggtccgggacaccaccacaagccggggctgggggaaggaactccctagtactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca BBa_K844000_sequence 1 catcatcaccatcaccaccatcatcaccattaataa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_M1652_sequence 1 atgcgtctgctggctgcggcactgttactgctgctgttggcgttgtataccgctcgcgttgatggcagtaaatgtaaatgttcacgcaaaggtccgaaaattcgctactctgatgtgaagaaactggaaatgaaaccgaaatatccgcactgtgaagaaaaaatggttatcatcaccacgaaaagcgttagccggtatcgcgggcaggaacactgcttgcatccgaaactccagtccaccaaacgctttatcaagtggtataatgcttggaatgaaaaaagacgcgtgtacgaggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z