BBa_M1674 1 BBa_M1674 cAMP responsive Promoter 2013-04-24T11:00:00Z 2015-05-08T01:13:57Z lac operon from E. Coli This promoter is segment copied from The Lac Operon which contains the catabolite activator protein (CAP) binding site and the Lac promoter. Low glucose concentration results in increased adenylate cyclase activity, which up-regulate the cAMP level. cAMP is able to bind to CAP and activate transcription of downstream gene. false false _768_ 0 16212 9 Not in stock false - false Lifu Xiao annotation2216754 1 lac promoter range2216754 1 43 72 annotation2216753 1 CAP binding site range2216753 1 10 24 BBa_M1674_sequence 1 cgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z