BBa_M1679 1 BBa_M1679 Fatty acid synthetase promoter 2013-04-24T11:00:00Z 2015-05-08T01:13:57Z unknown- rat/mouse FAS promoter is a 21-bp segment (+283/+303) of the fatty acid synthase (FAS) gene and is found to confer glucose responsiveness false false _768_ 0 16149 9 Not in stock false none false Swathi Swaminathan BBa_M1679_sequence 1 ggccgctgtcacgtgggcgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z