BBa_M1695 1 BBa_M1695 Promoter for ScrR 2013-04-09T11:00:00Z 2015-05-08T01:13:57Z Promoter for ScrR in Lactobacillus agilis as identified in NCBI gene database. This promoter is for the bacteria Lactobacillus agilis, it promotes for the protein ScrR at high efficiency. false false _768_ 0 16138 9 Not in stock false Needed to work in Lactobacillus. false Tiffany Hansen annotation2215025 1 promoter range2215025 1 1 31 BBa_M1695_sequence 1 catacaacatttttaaaaagcatggtataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z