BBa_M1700 1 BBa_M1700 L. Johnsonii transcription terminator 2013-04-14T11:00:00Z 2015-05-08T01:13:58Z From L. johnsonii derived by use of the Webgester DB. http://pallab.serc.iisc.ernet.in/gester/65481116/index.html A transcription terminator native to L. johnsonii NCC 533. This terminator originally exists downstream of the rpsR coding sequence. It was used in our project downstream from scrT to terminate transcription. This terminator has a deltaG of -12.33. false false _768_ 0 16137 9 Not in stock false This sequence was not altered in any way since it was to be used in L. johnsonii and that is the native organism from which it was derived. false S. Ivan Bartlett BBa_M1700_sequence 1 tctcatcgaatacgatgagaaaaataaaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z