BBa_M1697 1 BBa_M1697 Sucrose Mediated Regulatory Promoter 2013-04-10T11:00:00Z 2015-05-08T01:13:58Z (Br??ckner, 1996) Sucrose mediated promoter false false _768_ 0 16139 9 Not in stock false contains operator site for sucrose mediated repressor false Jonathan L. Wood annotation2214848 1 operator range2214848 1 40 56 annotation2214847 1 promoter range2214847 1 1 79 BBa_M1694 1 BBa_M1694 Ribosome binding site 2013-04-09T11:00:00Z 2015-05-08T01:13:57Z Ribosome binding site for ScrR in Lactobacillus sakei subsp. sakei as identified in NCBI gene database. This ribosome binding site initiates translation for the bacteria Lactobacillus. false false _768_ 0 16138 9 Not in stock false It needed to initiate for Lactobacillus. false Tiffany Hansen BBa_M1701 1 BBa_M1701 ScrR regulatory promoter and a RBS 2013-04-14T11:00:00Z 2015-05-08T01:13:58Z This is a combination of part M1696 and M1694 This is the promoter to which binds ScrR to regulate the transcription of a gene. We also added onto the end a RBS from Lactobacillus Sakei as identified on the NCBI website. false false _768_ 0 16135 9 Not in stock false We needed a promoter that ScrR regulates and a RBS that works in Lactobacillus, so we had to seek those out. false Benjamin L Hanks component2215033 1 BBa_M1694 component2215032 1 BBa_M1697 annotation2215032 1 BBa_M1697 range2215032 1 1 79 annotation2215033 1 BBa_M1694 range2215033 1 88 101 BBa_M1701_sequence 1 ttgaaaattaaaagaaaaatggtatgataaaaagtatattatggaaccggtaccatttaaatgagcttattttataaattactagagttcagggggggaaa BBa_M1694_sequence 1 ttcagggggggaaa BBa_M1697_sequence 1 ttgaaaattaaaagaaaaatggtatgataaaaagtatattatggaaccggtaccatttaaatgagcttattttataaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z