BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K123002 1 BBa_K123002 LacIQ ERE TetR 2008-10-27T12:00:00Z 2015-05-08T01:09:44Z The Estrogen Responsive Element was taken from the Human Estrogen Responsive Element This composite part contains LacIQ (BBa_I14032) and Estrogen Receptor Element (ERE) and TetR (BBa_C0040). The Estrogen Responsive element is to be used in conjunction with ER (Estrogen Receptor). This design involves ER binding to the ERE and disrupting the constituative promoter LacIQ from producing TetR via physically getting in the way of the polymerase. false false _241_ 0 2742 9 It's complicated true There is some data that suggests the ER is toxic to the cell. However in our experiments while we did see a decrease in growth rate we did not find ER to be fatal to the cell. true Jason Gardiner annotation1992722 1 SsrA range1992722 1 664 697 annotation1992723 1 BBa_C0040 range1992723 1 44 703 annotation1992719 1 -10 range1992719 1 26 31 annotation1992718 1 -35 range1992718 1 3 8 annotation1992733 1 ERE range1992733 1 43 57 annotation1992717 1 P(Lac) IQ range1992717 1 1 37 annotation1992721 1 tetR range1992721 1 47 663 annotation1992720 1 BBa_I14032 range1992720 1 1 37 annotation1992724 1 barcode range1992724 1 704 728 BBa_M1986 1 BBa_M1986 rpsT gene from Methylobacterium Chloromethanicum 2012-03-26T11:00:00Z 2015-05-08T01:13:58Z Methylobacterium Chloromethanicum. The sequence comes from the site http://www.ncbi.nlm.nih.gov/nuccore/218528082?from=359&to=625 The rpsT gene binds directly to the 16s rRNA and induces post translational inhibition of arginine and ornithine decarboxylase false false _768_ 0 12223 9 Not in stock false I copied and pasted the sequence from NCBI. false David Harris annotation2171189 1 Open reading frame range2171189 1 4 264 annotation2171187 1 Start codon range2171187 1 1 3 annotation2171188 1 Stop Codon range2171188 1 265 267 BBa_M1839 1 BBa_M1839 gfgf 2012-03-27T11:00:00Z 2015-05-08T01:13:58Z fgg gfg true false _768_ 0 12257 9 Discontinued false gfg false sarah guzman component2171671 1 BBa_K123002 component2171677 1 BBa_M1986 component2171673 1 BBa_B0034 component2171680 1 BBa_B0012 component2171678 1 BBa_B0010 annotation2171673 1 BBa_B0034 range2171673 1 751 762 annotation2171678 1 BBa_B0010 range2171678 1 1044 1123 annotation2171680 1 BBa_B0012 range2171680 1 1132 1172 annotation2171671 1 BBa_K123002 range2171671 1 1 742 annotation2171677 1 BBa_M1986 range2171677 1 769 1035 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K123002_sequence 1 tggtgcaaaacctttcgcggtatggcatgatagcgcctactagaggtcagagtgaccatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0034_sequence 1 aaagaggagaaa BBa_M1986_sequence 1 atggccaacaccgtgtcggccaagaagatgacccgcaagatcgccaagcgtacggcgatcaaccgctcgcgccgttcgcggatgcgtaccttcgtccgcaaggtcgaggaggcgattgcgtccggcgatcagggccaggccctcaccgccctccgcgccgccgagccggagatcatgcgcgctgcccagaacggcatcgttcacaagaacaatgcctcgcggaaggtttcccgcctggccgcccgcgtgaaggccatcgcggcctga BBa_M1839_sequence 1 tggtgcaaaacctttcgcggtatggcatgatagcgcctactagaggtcagagtgaccatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagaaagaggagaaatactagatggccaacaccgtgtcggccaagaagatgacccgcaagatcgccaagcgtacggcgatcaaccgctcgcgccgttcgcggatgcgtaccttcgtccgcaaggtcgaggaggcgattgcgtccggcgatcagggccaggccctcaccgccctccgcgccgccgagccggagatcatgcgcgctgcccagaacggcatcgttcacaagaacaatgcctcgcggaaggtttcccgcctggccgcccgcgtgaaggccatcgcggcctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z