BBa_M300058 1 BBa_M300058 gene 7 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z see others see others false false _102_ 0 1384 102 Not in stock false see others false Jennifer Chao annotation1917677 1 gene 7 range1917677 1 1 102 BBa_M300058_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcaaagatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z