BBa_M300063 1 BBa_M300063 gene 3 promoter 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z see others see othesr false false _102_ 0 1384 102 Not in stock false sese others false Jennifer Chao annotation1917905 1 gene 3 promoter range1917905 1 1 47 BBa_M300063_sequence 1 aattcacctcgaaagcaagctgataaaccgatacaattaaaggctcct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z