BBa_M30050 1 BBa_M30050 Refactoring of M13K07 genome 2007-02-27T12:00:00Z 2015-05-08T01:13:59Z M13K07 First, I will be unstuffing the genome, eliminating overlap to ease manipulation and any changes for engineering possibilities and ideas. I may also remove promoters that are embedded in another gene; and add bases or parts so see how that effects the external function of M13K07 genome. false false _102_ 0 1384 102 Not in stock false I had to consider where we were cutting; between the BamHI and the HpaI site. false Jennifer Chao annotation1917198 1 gene II promoter range1917198 1 1 55 BBa_M30050_sequence 1 aacaaaatattaacgtttacaatttaaatatttgcttatacaatcttcctgtttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z