BBa_M300060 1 BBa_M300060 gene 9 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z seeothers seeothers false false _102_ 0 1384 102 Not in stock false seeothers false Jennifer Chao annotation1917810 1 gene 9 range1917810 1 1 99 BBa_M300061 1 BBa_M300061 gene 8 promoter 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z see others see others false false _102_ 0 1384 102 Not in stock false seeothers false Jennifer Chao annotation1917859 1 gene 8 promoter range1917859 1 1 47 BBa_M300058 1 BBa_M300058 gene 7 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z see others see others false false _102_ 0 1384 102 Not in stock false see others false Jennifer Chao annotation1917677 1 gene 7 range1917677 1 1 102 BBa_M300062 1 BBa_M300062 gene 8 rbs 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z see others see others false false _102_ 0 1384 102 Not in stock false see others false Jennifer Chao annotation1917901 1 gene 8 rbs range1917901 1 1 16 BBa_M300052 1 BBa_M300052 m13k07 - Gene 3 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z m13k07 see others false false _102_ 0 1384 102 In stock false restriction enzymes false Jennifer Chao annotation1917245 1 gene 8 range1917245 1 1 222 BBa_M300059 1 BBa_M300059 gene 9 rbs 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z see others see others false false _102_ 0 1384 102 Not in stock false see others false Jennifer Chao annotation1917738 1 gene 8 rbs range1917738 1 1 19 BBa_M30091 1 BBa_M30091 M13K07 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z m13k07 we'd like to create cuts on various restriction sites to ease manipulation and changes according to engineering possibilities and ideas. false false _102_ 0 1384 102 Not in stock false restriction enzymes false Jennifer Chao component1917931 1 BBa_M300062 component1917929 1 BBa_M300060 component1917937 1 BBa_M300056 component1917923 1 BBa_M300058 component1917933 1 BBa_M300052 component1917925 1 BBa_M300061 component1917935 1 BBa_M300051 component1917927 1 BBa_M300059 annotation1917929 1 BBa_M300060 range1917929 1 191 289 annotation1917931 1 BBa_M300062 range1917931 1 298 313 annotation1917925 1 BBa_M300061 range1917925 1 111 157 annotation1917937 1 BBa_M300056 range1917937 1 605 621 annotation1917933 1 BBa_M300052 range1917933 1 320 541 annotation1917927 1 BBa_M300059 range1917927 1 166 184 annotation1917935 1 BBa_M300051 range1917935 1 550 596 annotation1917923 1 BBa_M300058 range1917923 1 1 102 BBa_M300056 1 BBa_M300056 gene 2 rbs 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z see others see others false false _102_ 0 1384 102 Not in stock false see ohers false Jennifer Chao annotation1917538 1 gene 2 rbs range1917538 1 1 17 BBa_M300051 1 BBa_M300051 m13k07 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z m13k07 unstuffing process, see gene II promoter false false _102_ 0 1384 102 Not in stock false restriction enzyme false Jennifer Chao annotation1917226 1 gene 3 promoter range1917226 1 1 47 BBa_M300062_sequence 1 taatggaaacttcctc BBa_M30091_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcaaagatgatactagagaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtctactagagtcgctgggggtcaaagatgtactagatgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcatgatactagagtaatggaaacttcctctactagatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctgatactagagattcacctcgaaagcaagctgataaaccgatacaattaaaggctccttactagagatcaaccggggtacata BBa_M300060_sequence 1 atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcatga BBa_M300052_sequence 1 atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga BBa_M300056_sequence 1 atcaaccggggtacata BBa_M300061_sequence 1 aatctccgttgtactttgtttcgcgcttggtataatcgctgggggtc BBa_M300051_sequence 1 attcacctcgaaagcaagctgataaaccgatacaattaaaggctcct BBa_M300058_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcaaagatga BBa_M300059_sequence 1 tcgctgggggtcaaagatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z