BBa_M31001 1 BBa_M31001 Refactoring of Gene 2 to remove gene 10 2007-02-27T12:00:00Z 2015-05-08T01:13:59Z M13 Gene 2 This is a part of the DNA where gene 2 and gene 10 overlap. Inorder to effectively allow for individual manipulation of separate genes, I am removing gene 10 and its RBS and promoter from gene 2. false false _102_ 0 1390 102 Not in stock false None false Mathangi Radha annotation1919690 1 AvrII range1919690 1 406 412 annotation1915175 1 Rbs X range1915175 1 55 70 annotation1919689 1 Apal range1919689 1 1 6 annotation1915176 1 Orf X range1915176 1 71 406 annotation1915174 1 gene X range1915174 1 6 54 BBa_M31001_sequence 1 gggccctctttttgatgcaatccgctttgcttctgactataatagtcagggtaaatttgagggggattcaatgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataacctagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z