BBa_M31005 1 BBa_M31005 M13K07 gene 5 refactored 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z M13K07 genomic sequence. The M13K07 gene 5 was refactored. false false _102_ 0 1386 102 Not in stock false Any overlaps with other genes in the M13K07 genome were eliminated and restriction enzyme sites were added for easier manipulation of the genes, such as insertion and deletion. false Iny Jhun annotation1917543 1 g5-promoter range1917543 1 7 56 annotation1917576 1 g5_RBS range1917576 1 48 63 annotation1917577 1 g5 range1917577 1 64 327 annotation1917540 1 XbaI range1917540 1 1 6 annotation1917542 1 XbaI range1917542 1 328 333 BBa_M31005_sequence 1 tctagaccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggtaattcacaatgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgttccggctaagtaatctaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z