BBa_M31010 1 BBa_M31010 M13K07 gene 10 refactored 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z M13K07 genomic sequence. The M13K07 gene 10 was refactored. false false _102_ 0 1386 102 Not in stock false Any overlaps with other genes in the M13K07 genome were eliminated and restriction enzyme sites were added for easier manipulation of the genes, such as insertion and deletion. false Iny Jhun annotation1917701 1 g10 range1917701 1 71 406 annotation1917704 1 SphI range1917704 1 407 412 annotation1917702 1 g10-promoter range1917702 1 7 54 annotation1917700 1 SphI range1917700 1 1 6 annotation1917703 1 g10-RBS range1917703 1 55 70 BBa_M31010_sequence 1 gcatgctctttttgatgcaatccgctttgcttctgactataatagtcagggtaaatttgagggggattcaatgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataagcatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z