BBa_M31201 1 BBa_M31201 Yeast CLB1 promoter region, G2/M cell cycle specific 2008-05-13T11:00:00Z 2015-05-08T01:13:59Z Yeast consensus sequence from SGD chrVII:703140..703639 Description of CLB1 (from SGD): B-type cyclin involved in cell cycle progression; activates Cdc28p to promote the transition from G2 to M phase; accumulates during G2 and M, then targeted via a destruction box motif for ubiquitin-mediated degradation by the proteasome. More information found here: http://db.yeastgenome.org/cgi-bin/locus.pl?locus=CLB1 false false _89_ 0 624 89 Not in stock false Part contains 500 bases upstream from the CLB1 ORF. Is NOT a minimal promoter, and has not been tested for composability. false Katherine Aull BBa_M31201_sequence 1 atttttacagcatcatttatgggtatcctgcaagttaggtgcggaacgtacataacatattacttcaatttgcgttccgcatacggtctgcccaatttgttttgtttgtgatttcctcattcgtcttcctctacagaaacgggtttgatccttcttttatgaatacggcgtgtagttatatatattaagtaatagaagttattgcacttctgtgtaagaagaagatactagggtgatctattctaggcaattttggttgtattgtgttttttacattcggccaaacttgagcaggctgcaattttagtgtcttcggtttttccagcgacagttttacttgtggctcttggtatagtttcttaaaactattaaagttgctaactggtgcagctgtttagatcacaaaagcgtaattaagaataagatctaccaacaagaacagagccaaaatattttcgtccgttatatcaaccatcaaaggaagctttaatcttctcata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z