BBa_M31232 1 BBa_M31232 Redesigned M13K07 Gene III Upstream 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z M13K07 Redesign of the upstream regulatory region of gene III false false _102_ 0 1388 102 Not in stock false None false Robert Warden annotation1917239 1 Gene III Promoter range1917239 1 1 48 annotation1917240 1 Gene III RBS range1917240 1 64 79 annotation1919067 1 EagI range1919067 1 52 57 BBa_M31232_sequence 1 aattcacctcgaaagcaagctgataaaccgatacaattaaaggctccttttcggccgtttttttttggagattttcaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z