BBa_M31252 1 BBa_M31252 Redesigned M13K07 Gene V Upstream 2007-02-27T12:00:00Z 2015-05-08T01:13:59Z M13K07 Redesigned upstream regulatory region of Gene V false false _102_ 0 1388 102 Not in stock false None false Robert Warden annotation1918697 1 NcoI range1918697 1 51 56 annotation1917190 1 Gene V Promoter range1917190 1 1 50 annotation1917191 1 Gene V RBS range1917191 1 57 72 BBa_M31252_sequence 1 ccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggtaccatggcataaggtaattcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z