BBa_M13505 1 BBa_M13505 M13KO7 gene V RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene V message (BBa_M13005). The part aligns with base pairs 827-842 in M13K07 genome. It was identified as the RBS for the gene V message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13507 1 BBa_M13507 M13KO7 gene VII RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene VII message (BBa_M13007). The part aligns with base pairs 1092-1107 in M13K07 genome. It was identified as the RBS for gene VII message by Wezenbeek et al in Gene (1980) 11: 129-148 false true _45_ 0 314 1 Not in stock false New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban false Natalie Kuldell BBa_M31384 1 BBa_M31384 XbaI Restriction Site 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z Known XbaI Restriction Enzyme Site XbaI Restriction Site: T^CTAG_A false false _102_ 0 1395 102 Not in stock false Known Sequence false Michael Oh BBa_M31380 1 BBa_M31380 ApaI Restriction Site 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z Known Restriction Enzyme Site ApaI Restriction Site: G_GGCC^C false false _102_ 0 1395 102 Not in stock false Known Sequence false Michael Oh BBa_M31373 1 BBa_M31373 First Half of M13K07 g3 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 phage genome Codes for the g3 ORF of M13K07 phage until the BamHI unique restriction site. false false _102_ 0 1395 102 Not in stock false Cut at BamHI restriction site false Michael Oh annotation1918449 1 BamHI range1918449 1 642 642 BBa_M31378 1 BBa_M31378 M13K07 g8 ORF -Promoter g3 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 phage genome Contains the M13K07 g8 open reading frame with the g3 promoter overlap removed by silent mutation. false false _102_ 0 1395 102 Not in stock false Change codons in relevant sequences so that amino acid sequence is the same false Michael Oh BBa_M13509 1 BBa_M13509 M13Ko7 gene IX RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene IX message (BBa_M13009). The part aligns with base pairs 1190-1205 in M13K07 genome. It was identified as the RBS for gene IX message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M31375 1 BBa_M31375 M13K07 g5 ORF -RBS g7 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 g5 open reading frame Contains the open reading frame of g5 from the M13K07 phage genome. The last few codons are silently mutated to remove the g5 RBS sequence. false false _102_ 0 1395 102 Not in stock false Changed every other codon in the RBS sequence but maintained the same amino acid sequence. false Michael Oh annotation1919583 1 BsrGI range1919583 1 179 184 BBa_M13503 1 BBa_M13503 M13K07 gene III RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene III message (BBa_M13003). The part aligns with base pairs 1563-1578 in M13K07 genome. It was identified as the RBS for gene III message by Wezenbeek et al in Gene (1980) 11: 129-148 New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13508 1 BBa_M13508 M13K07 gene VIII RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene VIII message (BBa_M13008). The part aligns with base pairs 1285-1300 in M13K07 genome. It was identified as the RBS for gene VIII message by Wezenbeek et al in Gene (1980) 11: 129-148 false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M31377 1 BBa_M31377 M13K07 g7 ORF -Promoter g8 -RBS g9 -ORF g9 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 phage genome g7 ORF Contains the M13K07 g7 open reading frame with the g8 promoter, g9 RBS, and g9 ORF sequences and overlaps removed by silent mutation. false false _102_ 0 1395 102 Not in stock false Change codons in relevant sequences so that amino acid sequence is the same false Michael Oh BBa_M31379 1 BBa_M31379 M13K07 g9 ORF -RBS g8 -ORF g8 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 phage genome Contains the M13K07 g9 open reading frame with the g8 RBS, and g8 ORF sequences and overlaps removed by silent mutation. false false _102_ 0 1395 102 Not in stock false Change codons in relevant sequences so that amino acid sequence is the same false Michael Oh annotation1919633 1 SnaBI range1919633 1 63 68 BBa_M13103 1 BBa_M13103 M13K07 gene III promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 1500-1547 in M13K07. It directs transcription of M13 gene III (BBa_M13503, BBa_M13003). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M31383 1 BBa_M31383 NcoI Restriction Site 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z Known NcoI Restriction Enzyme Site NcoI Restriction Site: C^CATG_G false false _102_ 0 1395 102 Not in stock false Known Sequence false Michael Oh BBa_M13105 1 BBa_M13105 M13K07 gene V promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 786-835 in M13K07. It directs transcription of M13 gene V (BBa_M13505, BBa_M13005). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M31372 1 BBa_M31372 Second Half of M13K07 g2 -Promoter g5 -RBS g5 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 phage genome Starts with the HpaI unique restriction site in M13K07 genome and continues until the stop codon of gII. false false _102_ 0 1395 102 Not in stock false Cut after HpaI restriction site false Michael Oh annotation1918411 1 Promoter g10 range1918411 1 381 428 annotation1918410 1 RBS g10 range1918410 1 480 495 annotation1918409 1 g10 range1918409 1 496 831 annotation1918394 1 HpaI range1918394 1 1 3 BBa_M31370 1 BBa_M31370 tacI Promoter 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z Derived from trp and lac promoter sequences. Allows for regulation of following gene with laqIq and IPTG...laqIq in same plasmid represses the promoter and IPTG proportionally depresses the promoter (Boer, et al., 1983). false false _102_ 0 1395 102 Not in stock false Took sequence from Boer, 1983 paper. false Michael Oh BBa_M31381 1 BBa_M31381 BssHII Restriction Site 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z Known BssHII Restriction Enzyme Site BssHII Restriction Site: G_CGCG^C false true _102_ 0 1395 102 Not in stock false Known Sequence false Michael Oh BBa_M31382 1 BBa_M31382 EcoRI Restriction Site 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z Known EcoRI Restriction Enzyme Site EcoRI Restriction Site: G^AATT_C false true _102_ 0 1395 102 Not in stock false Known Sequence false Michael Oh BBa_M31270 1 BBa_M31270 M13.1: Refactored M13K07 Phage 2007-02-27T12:00:00Z 2015-05-08T01:13:59Z The source DNA is bases 1-2435 from the M13K07 phage, which is bounded by the HpaI and BamHI restriction sites. The following sequence of DNA is drawn from the M13K07 phage plasmid, specifically the section between the HpaI and BamHI restriction sites. This section incorporates all or parts of seven open reading frames, many of which are overlapping in the wild-type genotype. The result is a synthetic biology-oriented genome that can be better understood and hopefully will be more easily manipulated for bioengineering purposes. false false _102_ 0 1395 102 Not in stock false Overlaps were eliminated through direct duplication of appropriate sequences. Homologous recombination possibilities were diminished by silent mutation of the first instance of duplicated codons. About half the duplicated codons were changed in this manner. false Michael Oh component2237218 1 BBa_M31370 component2237217 1 BBa_M31383 component2237207 1 BBa_M13505 component2237210 1 BBa_M31381 component2237212 1 BBa_M31377 component2237223 1 BBa_M13503 component2237214 1 BBa_M13509 component2237205 1 BBa_M31380 component2237216 1 BBa_M31379 component2237204 1 BBa_M31372 component2237224 1 BBa_M31373 component2237206 1 BBa_M13105 component2237213 1 BBa_M31382 component2237222 1 BBa_M13103 component2237211 1 BBa_M13507 component2237221 1 BBa_M31384 component2237219 1 BBa_M13508 component2237209 1 BBa_M31375 component2237220 1 BBa_M31378 annotation2237214 1 BBa_M13509 range2237214 1 1299 1314 annotation2237223 1 BBa_M13503 range2237223 1 1789 1804 annotation2237206 1 BBa_M13105 range2237206 1 839 888 annotation2237204 1 BBa_M31372 range2237204 1 1 832 annotation2237212 1 BBa_M31377 range2237212 1 1191 1292 annotation2237217 1 BBa_M31383 range2237217 1 1414 1419 annotation2237210 1 BBa_M31381 range2237210 1 1169 1174 annotation2237219 1 BBa_M13508 range2237219 1 1488 1503 annotation2237207 1 BBa_M13505 range2237207 1 889 904 annotation2237205 1 BBa_M31380 range2237205 1 833 838 annotation2237224 1 BBa_M31373 range2237224 1 1805 2446 annotation2237213 1 BBa_M31382 range2237213 1 1293 1298 annotation2237216 1 BBa_M31379 range2237216 1 1315 1413 annotation2237222 1 BBa_M13103 range2237222 1 1741 1788 annotation2237211 1 BBa_M13507 range2237211 1 1175 1190 annotation2237209 1 BBa_M31375 range2237209 1 905 1168 annotation2237220 1 BBa_M31378 range2237220 1 1504 1725 annotation2237218 1 BBa_M31370 range2237218 1 1420 1487 annotation2237221 1 BBa_M31384 range2237221 1 1726 1740 BBa_M31373_sequence 1 gtgaaaaaattattattcgcaattcctttagttgttcctttctattctcactccgctgaaactgttgaaagttgtttagcaaaaccccatacagaaaattcatttactaacgtctggaaagacgacaaaactttagatcgttacgctaactatgagggttgtctgtggaatgctacaggcgttgtagtttgtactggtgacgaaactcagtgttacggtacatgggttcctattgggcttgctatccctgaaaatgagggtggtggctctgagggtggcggttctgagggtggcggttctgagggtggcggtactaaacctcctgagtacggtgatacacctattccgggctatacttatatcaaccctctcgacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatccttctcttgaggagtctcagcctcttaatactttcatgtttcagaataataggttccgaaataggcagggggcattaactgtttatacgggcactgttactcaaggcactgaccccgttaaaacttattaccagtacactcctgtatcatcaaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctttccattctggctttaatgag BBa_M13503_sequence 1 tttggagattttcaac BBa_M13105_sequence 1 ccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggta BBa_M31377_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatttccgtagtactatgtttggcgctaggtattatcgcagggggacaaaggtga BBa_M31380_sequence 1 gggccc BBa_M13507_sequence 1 gttccggctaagtaac BBa_M13103_sequence 1 aattcacctcgaaagcaagctgataaaccgatacaattaaaggctcct BBa_M31383_sequence 1 ccatgg BBa_M31379_sequence 1 atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcatga BBa_M31375_sequence 1 atgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgtaccggcaaactaa BBa_M13508_sequence 1 taatggaaacttcctc BBa_M31384_sequence 1 ttttctagatttttt BBa_M31378_sequence 1 atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaatttacctccaaagctagttga BBa_M31270_sequence 1 aacgctactactattagtagaattgatgccaccttttcagctcgcgccccaaatgaaaatatagctaaacaggttattgaccatttgcgaaatgtatctaatggtcaaactaaatctactcgttcgcagaaatgggagtcaacagttaacatggaatgaaacttccagacaccgtactttagttgcatatttaaaacatgttgagctacagcaccagattcagcaattaagctctaagccatccgcaaaaatgacctcttatcaaaaggagcaattaaaggtactctctaatcctgacctgttggagtttgcttccggtctggttcgctttgaagctcgaattaaaacgcgatatttgaagtctttcgggcttcctcttaatctttttgatgcaatccgctttgcttctgactataatagtcagggtaaagacctgatttttgatttatggtcattctcgttttctgaactgtttaaagcatttgagggggattcaatgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcttaagggcccccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggtacataaggtaattcacaatgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgtaccggcaaactaagcgcgcgttccggctaagtaacatggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatttccgtagtactatgtttggcgctaggtattatcgcagggggacaaaggtgagaattctcgctgggggtcaaagatgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcatgaccatgggagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttcacacataatggaaacttcctcatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaatttacctccaaagctagttgattttctagattttttaattcacctcgaaagcaagctgataaaccgatacaattaaaggctccttttggagattttcaacgtgaaaaaattattattcgcaattcctttagttgttcctttctattctcactccgctgaaactgttgaaagttgtttagcaaaaccccatacagaaaattcatttactaacgtctggaaagacgacaaaactttagatcgttacgctaactatgagggttgtctgtggaatgctacaggcgttgtagtttgtactggtgacgaaactcagtgttacggtacatgggttcctattgggcttgctatccctgaaaatgagggtggtggctctgagggtggcggttctgagggtggcggttctgagggtggcggtactaaacctcctgagtacggtgatacacctattccgggctatacttatatcaaccctctcgacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatccttctcttgaggagtctcagcctcttaatactttcatgtttcagaataataggttccgaaataggcagggggcattaactgtttatacgggcactgttactcaaggcactgaccccgttaaaacttattaccagtacactcctgtatcatcaaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctttccattctggctttaatgag BBa_M13505_sequence 1 cataaggtaattcaca BBa_M13509_sequence 1 tcgctgggggtcaaag BBa_M31370_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttcacaca BBa_M31372_sequence 1 aacgctactactattagtagaattgatgccaccttttcagctcgcgccccaaatgaaaatatagctaaacaggttattgaccatttgcgaaatgtatctaatggtcaaactaaatctactcgttcgcagaaatgggagtcaacagttaacatggaatgaaacttccagacaccgtactttagttgcatatttaaaacatgttgagctacagcaccagattcagcaattaagctctaagccatccgcaaaaatgacctcttatcaaaaggagcaattaaaggtactctctaatcctgacctgttggagtttgcttccggtctggttcgctttgaagctcgaattaaaacgcgatatttgaagtctttcgggcttcctcttaatctttttgatgcaatccgctttgcttctgactataatagtcagggtaaagacctgatttttgatttatggtcattctcgttttctgaactgtttaaagcatttgagggggattcaatgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcttaa BBa_M31381_sequence 1 gcgcgc BBa_M31382_sequence 1 gaattc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z