BBa_M31282 1 BBa_M31282 Redesigned M13K07 Gene VIII Upstream 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 Redesign of the regulatory region upstream of gene VII false false _102_ 0 1388 102 Not in stock false None false Robert Warden annotation1917213 1 Gene VIII RBS range1917213 1 131 146 annotation1919023 1 FseI range1919023 1 123 130 annotation1917212 1 Gene VIII Promoter range1917212 1 1 47 BBa_M31282_sequence 1 aatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcaaagtatagtgtattctaacgggtcaatcgtaatagcatggtgccttcgtagtcccattacgtatatatacgggtggccggcctaatggaaacttcctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z