BBa_M31292 1 BBa_M31292 Redesigned M13K07 Gene IX Upstream 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 Redesign of the Gene IX upstream regulatory region false false _102_ 0 1388 102 Not in stock false None false Robert Warden annotation1917255 1 Gene VIII Promoter range1917255 1 1 47 annotation1918733 1 KasI range1918733 1 48 53 annotation1917257 1 Gene IX RBS range1917257 1 54 69 BBa_M31292_sequence 1 aatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcggcgcctcgctgggggtcaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z