BBa_M31302 1 BBa_M31302 Redesigned M13K07 Gene X Upstream 2007-02-27T12:00:00Z 2015-05-08T01:14:00Z M13K07 Redesign of the upstream area of gene X false false _102_ 0 1388 102 Not in stock false Pulled out of Gene II false Robert Warden annotation1917187 1 Gene X RBS range1917187 1 100 115 annotation1918695 1 SalI range1918695 1 60 65 annotation1917186 1 Gene X Promoter range1917186 1 1 48 BBa_M31302_sequence 1 tctttttgatgcaatccgctttgcttctgactataatagtcagggtaaagacctgaaatgtcgactatgctcatagtgcttaactgaactgaaatttgcatatgagcgcgattca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z