BBa_M31339 1 g8 M13K07 g8 (promoter + RBS + ORF) 2007-03-01T12:00:00Z 2015-05-08T01:14:00Z M13K07 sequence This contains the open reading frame of gene 8 of the bacteriophage M13K07. It codes for p8, an integral coat protein. false false _102_ 0 1379 102 Not in stock false Uncoupling from gene 9 ORF false David Ying component1919770 1 BBa_M13008 component1919768 1 BBa_M13108 component1919769 1 BBa_M13508 annotation1919770 1 BBa_M13008 range1919770 1 64 285 annotation1919769 1 BBa_M13508 range1919769 1 48 63 annotation1919768 1 BBa_M13108 range1919768 1 1 47 BBa_M13008 1 BBa_M13008 M13KO7 gene VIII 2006-12-12T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes the major coat protein, with approximately 2700 copies of the protein on each phage particle. The protein is first synthesized at a longer precursor protein that is clipped between the Alanines at positions 23 and 24. It is possible to silently add a Pst site to clone fusions upstream and in frame with Ala that begins mature protein. Small peptide-fusions are possible to the N-terminal portion of the mature p8 (phage display systems are built around this finding) but addition of more than 6 or 8 residues makes the phage pack poorly, leading to unproductive infections. false true _45_ 0 314 1 In stock false Many! The start codon for gene 8 overlaps with the stop codon for the upstream gene 9. Might be nice to include cloning sites for directed N-terminal fusions to mature form of protein. Might be nice to codon vary a different biobrick of gene VIII to allow for two genes expressed on single genome, inhibiting recombination in ssDNA. false Natalie Kuldell BBa_M13508 1 BBa_M13508 M13K07 gene VIII RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene VIII message (BBa_M13008). The part aligns with base pairs 1285-1300 in M13K07 genome. It was identified as the RBS for gene VIII message by Wezenbeek et al in Gene (1980) 11: 129-148 false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13108 1 BBa_M13108 M13K07 gene VIII promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 1155-1201 in M13K07. It directs transcription of M13 gene VIII (BBa_M13508, BBa_M13008). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13008_sequence 1 atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga BBa_M13508_sequence 1 taatggaaacttcctc BBa_M13108_sequence 1 aatctccgttgtactttgtttcgcgcttggtataatcgctgggggtc BBa_M31339_sequence 1 aatctccgttgtactttgtttcgcgcttggtataatcgctgggggtctaatggaaacttcctcatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z