BBa_M13507 1 BBa_M13507 M13KO7 gene VII RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene VII message (BBa_M13007). The part aligns with base pairs 1092-1107 in M13K07 genome. It was identified as the RBS for gene VII message by Wezenbeek et al in Gene (1980) 11: 129-148 false true _45_ 0 314 1 Not in stock false New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban false Natalie Kuldell BBa_M31340 1 BBa_M31340 M13K07 g7 (RBS + ORF) 2007-03-01T12:00:00Z 2015-05-08T01:14:00Z M13K07 sequence This part consists of the M13K07's gene 7 ORF preceded by its RBS. g7 has no known promoter. false false _102_ 0 1379 102 Not in stock false Decoupling from g8 promoter, g9 RBS and g9 ORF false David Ying component1920257 1 BBa_M13007 component1920256 1 BBa_M13507 annotation1920257 1 BBa_M13007 range1920257 1 17 118 annotation1920256 1 BBa_M13507 range1920256 1 1 16 BBa_M13007 1 BBa_M13007 M13K07 gene VII 2006-12-11T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is presented with p9 to initiate phage assembly at the blunt end of the phage coat. Approximately 5 copies of each protein are presented on mature phage. Without p9 or p7, no phage is produced. p7 is one of the smallest ribosomally translated proteins with described function. It is hydrophobic and the N-terminus is negatively charged, suggesting a C-terminus inside orientation. false true _45_ 0 314 1 Not in stock false stop codon overlaps with p9 start codon in M13 genome. false Natalie Kuldell BBa_M13007_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcaaagatga BBa_M13507_sequence 1 gttccggctaagtaac BBa_M31340_sequence 1 gttccggctaagtaacatggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcaaagatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z