BBa_M31341 1 BBa_M31341 M13K07 g9 (RBS + ORF) 2007-03-06T12:00:00Z 2015-05-08T01:14:00Z M13K07 genome M13K07 bacteriophage gene 9, including its RBS and ORF false false _102_ 0 1379 102 Not in stock false Separating it from other elements false David Ying component1920263 1 BBa_M13009 component1920262 1 BBa_M13509 annotation1920262 1 BBa_M13509 range1920262 1 1 16 annotation1920263 1 BBa_M13009 range1920263 1 17 115 BBa_M13509 1 BBa_M13509 M13Ko7 gene IX RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene IX message (BBa_M13009). The part aligns with base pairs 1190-1205 in M13K07 genome. It was identified as the RBS for gene IX message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13009 1 BBa_M13009 M13K07 gene IX 2006-12-11T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is presented with p7 to initiate phage assembly at the blunt end of the phage coat. Approximately 5 copies of each protein are presented on mature phage. In the absence of p9 or p7, no phage is produced. p9 is one of the smallest ribosomally translated proteins with described function. N-terminal display is possible, and some positively charged residues are seen at the C-terminal end of the protein, suggesting a "C-terminus inside" orientation. false true _45_ 0 314 1 Not in stock false start codon overlaps with stop codon of g7 upstream and stop codon overlaps with start codon of g8 downstream. false Natalie Kuldell BBa_M13009_sequence 1 atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcatga BBa_M13509_sequence 1 tcgctgggggtcaaag BBa_M31341_sequence 1 tcgctgggggtcaaagatgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z