BBa_M31370 1 BBa_M31370 tacI Promoter 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z Derived from trp and lac promoter sequences. Allows for regulation of following gene with laqIq and IPTG...laqIq in same plasmid represses the promoter and IPTG proportionally depresses the promoter (Boer, et al., 1983). false false _102_ 0 1395 102 Not in stock false Took sequence from Boer, 1983 paper. false Michael Oh BBa_M31370_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z