BBa_M31375 1 BBa_M31375 M13K07 g5 ORF -RBS g7 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 g5 open reading frame Contains the open reading frame of g5 from the M13K07 phage genome. The last few codons are silently mutated to remove the g5 RBS sequence. false false _102_ 0 1395 102 Not in stock false Changed every other codon in the RBS sequence but maintained the same amino acid sequence. false Michael Oh annotation1919583 1 BsrGI range1919583 1 179 184 BBa_M31375_sequence 1 atgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgtaccggcaaactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z