BBa_M31377 1 BBa_M31377 M13K07 g7 ORF -Promoter g8 -RBS g9 -ORF g9 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 phage genome g7 ORF Contains the M13K07 g7 open reading frame with the g8 promoter, g9 RBS, and g9 ORF sequences and overlaps removed by silent mutation. false false _102_ 0 1395 102 Not in stock false Change codons in relevant sequences so that amino acid sequence is the same false Michael Oh BBa_M31377_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatttccgtagtactatgtttggcgctaggtattatcgcagggggacaaaggtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z