BBa_M31378 1 BBa_M31378 M13K07 g8 ORF -Promoter g3 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 phage genome Contains the M13K07 g8 open reading frame with the g3 promoter overlap removed by silent mutation. false false _102_ 0 1395 102 Not in stock false Change codons in relevant sequences so that amino acid sequence is the same false Michael Oh BBa_M31378_sequence 1 atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaatttacctccaaagctagttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z