BBa_M13505 1 BBa_M13505 M13KO7 gene V RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene V message (BBa_M13005). The part aligns with base pairs 827-842 in M13K07 genome. It was identified as the RBS for the gene V message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13507 1 BBa_M13507 M13KO7 gene VII RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene VII message (BBa_M13007). The part aligns with base pairs 1092-1107 in M13K07 genome. It was identified as the RBS for gene VII message by Wezenbeek et al in Gene (1980) 11: 129-148 false true _45_ 0 314 1 Not in stock false New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban false Natalie Kuldell BBa_M13110 1 BBa_M13110 M13110 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 381-428 in M13K07. It directs transcription of M13 gene X (BBa_M13510, BBa_M13010). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13509 1 BBa_M13509 M13Ko7 gene IX RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene IX message (BBa_M13009). The part aligns with base pairs 1190-1205 in M13K07 genome. It was identified as the RBS for gene IX message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13502 1 BBa_M13502 M13KO7 gene II RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene II message (BBa_M13002). The part aligns with base pairs 8252-8267 in M13K07 genome. It was identified as the RBS for gene II message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13007 1 BBa_M13007 M13K07 gene VII 2006-12-11T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is presented with p9 to initiate phage assembly at the blunt end of the phage coat. Approximately 5 copies of each protein are presented on mature phage. Without p9 or p7, no phage is produced. p7 is one of the smallest ribosomally translated proteins with described function. It is hydrophobic and the N-terminus is negatively charged, suggesting a C-terminus inside orientation. false true _45_ 0 314 1 Not in stock false stop codon overlaps with p9 start codon in M13 genome. false Natalie Kuldell BBa_M13510 1 BBa_M13510 M13KO7 gene X RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene X message (BBa_M13010). The part aligns with base pairs 480-495 in M13K07 genome. It was identified as the RBS for gene II message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13010 1 BBa_M13010 M13K07 gene X 2006-12-05T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is important for phage maturation. The protein remains in the host cytoplasm to interact with the product of gI and the OM pore (product of gIV) through which the phage ssDNA is threaded as the phage matures. GeneX protein is identical to the C-terminal portion of the gIprotein since gXprotien is normally encoded through an internal initiation of translation from the gI transcript. false true _45_ 0 314 1 Not in stock false need to unstuff from inside gI false Natalie Kuldell BBa_M13503 1 BBa_M13503 M13K07 gene III RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene III message (BBa_M13003). The part aligns with base pairs 1563-1578 in M13K07 genome. It was identified as the RBS for gene III message by Wezenbeek et al in Gene (1980) 11: 129-148 New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13102 1 BBa_M13102 M13K07 gene II promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome. It directs transcription of M13 gene II (BBa_M13502, BBa_M13002). Promoter identified in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13508 1 BBa_M13508 M13K07 gene VIII RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene VIII message (BBa_M13008). The part aligns with base pairs 1285-1300 in M13K07 genome. It was identified as the RBS for gene VIII message by Wezenbeek et al in Gene (1980) 11: 129-148 false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13009 1 BBa_M13009 M13K07 gene IX 2006-12-11T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is presented with p7 to initiate phage assembly at the blunt end of the phage coat. Approximately 5 copies of each protein are presented on mature phage. In the absence of p9 or p7, no phage is produced. p9 is one of the smallest ribosomally translated proteins with described function. N-terminal display is possible, and some positively charged residues are seen at the C-terminal end of the protein, suggesting a "C-terminus inside" orientation. false true _45_ 0 314 1 Not in stock false start codon overlaps with stop codon of g7 upstream and stop codon overlaps with start codon of g8 downstream. false Natalie Kuldell BBa_M13103 1 BBa_M13103 M13K07 gene III promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 1500-1547 in M13K07. It directs transcription of M13 gene III (BBa_M13503, BBa_M13003). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13002 1 BBa_M13002 M13K07 gene II 2006-12-13T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is important for phage DNA replication, initiating ssDNA synthesis of the (+) strand by nicking the RF near the M13 replication origin. p10 is encoded within gII thanks to a translation re-initiation event. false false _45_ 0 314 1 Not in stock false need to unstuff gX from within coding sequence. RBS for downstream gV overlaps the gII stop codon. false Natalie Kuldell BBa_M13105 1 BBa_M13105 M13K07 gene V promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 786-835 in M13K07. It directs transcription of M13 gene V (BBa_M13505, BBa_M13005). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13003 1 BBa_M13003 M13K07 gene III 2006-12-13T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome, encoding a minor coat protein. Approximately 5 copies of p3 are presented with 5 copies of p6 on the rounded end of the mature phage. In the absence of p3, the phage remains tethered to the bacterial host, elongating to 10 or 20 times the normal phage length and incorporating multiple ssDNA genomes within the coat. p3 (domain II) is also responsible for the initial interaction of the phage with the bacterial pili during infection. Peptide fusions, sometimes large, can be displayed on N-terminal end of p3, though highly charged fusions are difficult to isolate since they are not easily secreted by the host secretion apparatus. The p3 protein is first synthesized as a longer precursor protein that is 18 amino acids longer than the mature protein. The gene's translation initiates with a GTG codon, and changing this codon to an ATG increases expression of gene III to levels with negative effects on phage maturation. false false _45_ 0 314 1 Not in stock false The RBS for gene III is within the transcription termination sequence of the upstream gVIII, thus modifications to termination affect gIII initiation. Translation initiates with a GTG rather than a canonical ATG. There is a unique, natural BamHI site in domain II that may be useful for cloning, though it may prevent interaction of p3 with pilus. false Natalie Kuldell BBa_M13008 1 BBa_M13008 M13KO7 gene VIII 2006-12-12T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes the major coat protein, with approximately 2700 copies of the protein on each phage particle. The protein is first synthesized at a longer precursor protein that is clipped between the Alanines at positions 23 and 24. It is possible to silently add a Pst site to clone fusions upstream and in frame with Ala that begins mature protein. Small peptide-fusions are possible to the N-terminal portion of the mature p8 (phage display systems are built around this finding) but addition of more than 6 or 8 residues makes the phage pack poorly, leading to unproductive infections. false true _45_ 0 314 1 In stock false Many! The start codon for gene 8 overlaps with the stop codon for the upstream gene 9. Might be nice to include cloning sites for directed N-terminal fusions to mature form of protein. Might be nice to codon vary a different biobrick of gene VIII to allow for two genes expressed on single genome, inhibiting recombination in ssDNA. false Natalie Kuldell BBa_M31530 1 BBa_M31530 Refactored Portion of M13K07 Genome 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z This part does not yet exist in a physical form, though it may be synthesized in the near future. I've refactored the segment of DNA between the unique HapI and BamHI sites. Following the guidlines in "Refactoring T7" by Chan et al, I've determined what functional components that I would like to be physically separated from one another (namely regulatory regions and ORFs)and set them apart in my design. I'm not sure that these modifications will yield a functional phage. Even viable phage result, I don't know what sort of emergent functions I will have created by refactoring the genome. false false _102_ 0 1380 102 Not in stock false In order to organize the M13K07 genome into individual components, some sequences must be "copied and pasted" elsewhere. This opens the possibility for recomination events or coding regions that code for functions for which they are no longer responsible (legacy functions). These interactions must be addressed to avoid interactions bewteen stretches of DNA. As far as I know, this can be addressed by changing codon usage, introducing inhibitory secondary structures to the DNA, or by eliminating the enzymatic mechanisms by which these events may occur. I'm sure there are others. Another consideration is that absolute and relative position in the genome may be of importance. I will try to maintain the "localities" as best I can so as not to introduce further sources of problems. false Matt Gethers component1917681 1 BBa_M13502 component1917693 1 BBa_M13108 component1917684 1 BBa_M13510 component1917686 1 BBa_M13105 component1917695 1 BBa_M13008 component1917692 1 BBa_M13009 component1917687 1 BBa_M13505 component1917683 1 BBa_M13110 component1917691 1 BBa_M13509 component1917680 1 BBa_M13102 component1917688 1 BBa_M13005 component1917694 1 BBa_M13508 component1917698 1 BBa_M13003 component1917685 1 BBa_M13010 component1917689 1 BBa_M13507 component1917697 1 BBa_M13503 component1917682 1 BBa_M13002 component1917690 1 BBa_M13007 component1917696 1 BBa_M13103 annotation1917693 1 BBa_M13108 range1917693 1 2261 2307 annotation1917689 1 BBa_M13507 range1917689 1 2028 2043 annotation1917680 1 BBa_M13102 range1917680 1 1 48 annotation1917695 1 BBa_M13008 range1917695 1 2324 2545 annotation1917690 1 BBa_M13007 range1917690 1 2044 2145 annotation1917686 1 BBa_M13105 range1917686 1 1698 1747 annotation1917681 1 BBa_M13502 range1917681 1 49 64 annotation1917687 1 BBa_M13505 range1917687 1 1748 1763 annotation1917692 1 BBa_M13009 range1917692 1 2162 2260 annotation1917698 1 BBa_M13003 range1917698 1 2610 3884 annotation1917696 1 BBa_M13103 range1917696 1 2546 2593 annotation1917688 1 BBa_M13005 range1917688 1 1764 2027 annotation1917691 1 BBa_M13509 range1917691 1 2146 2161 annotation1917682 1 BBa_M13002 range1917682 1 65 1297 annotation1917683 1 BBa_M13110 range1917683 1 1298 1345 annotation1917684 1 BBa_M13510 range1917684 1 1346 1361 annotation1917694 1 BBa_M13508 range1917694 1 2308 2323 annotation1917697 1 BBa_M13503 range1917697 1 2594 2609 annotation1917685 1 BBa_M13010 range1917685 1 1362 1697 BBa_M13005 1 BBa_M13005 M13K07 gene V 2006-12-11T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a single stranded DNA binding protein that is important for phage maturation. false false _45_ 0 314 1 Not in stock false RBS for gene V overlaps stop codon for upstream phage genes II and X. false Natalie Kuldell BBa_M13108 1 BBa_M13108 M13K07 gene VIII promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 1155-1201 in M13K07. It directs transcription of M13 gene VIII (BBa_M13508, BBa_M13008). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13502_sequence 1 atcaaccggggtacat BBa_M13503_sequence 1 tttggagattttcaac BBa_M13007_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcaaagatga BBa_M13105_sequence 1 ccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggta BBa_M13009_sequence 1 atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcatga BBa_M13108_sequence 1 aatctccgttgtactttgtttcgcgcttggtataatcgctgggggtc BBa_M13507_sequence 1 gttccggctaagtaac BBa_M13002_sequence 1 atgattgacatgctagttttacgattaccgttcatcgattctcttgtttgctccagactctcaggcaatgacctgatagcctttgtagacctctcaaaaatagctaccctctccggcatgaatttatcagctagaacggttgaatatcatattgatggtgatttgactgtctccggcctttctcacccttttgaatctttacctacacattactcaggcattgcatttaaaatatatgagggttctaaaaatttttatccttgcgttgaaataaaggcttctcccgcaaaagtattacagggtcataatgtttttggtacaaccgatttagctttatgctctgaggctttattgcttaattttgctaattctttgccttgcctgtatgatttattggatgttaacgctactactattagtagaattgatgccaccttttcagctcgcgccccaaatgaaaatatagctaaacaggttattgaccatttgcgaaatgtatctaatggtcaaactaaatctactcgttcgcagaattgggaatcaactgttacatggaatgaaacttccagacaccgtactttagttgcatatttaaaacatgttgagctacagcaccagattcagcaattaagctctaagccatccgcaaaaatgacctcttatcaaaaggagcaattaaaggtactctctaatcctgacctgttggagtttgcttccggtctggttcgctttgaagctcgaattaaaacgcgatatttgaagtctttcgggcttcctcttaatctttttgatgcaatccgctttgcttctgactataatagtcagggtaaagacctgatttttgatttatggtcattctcgttttctgaactgtttaaagcatttgagggggattcaatgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataa BBa_M13510_sequence 1 atttgagggggattca BBa_M13103_sequence 1 aattcacctcgaaagcaagctgataaaccgatacaattaaaggctcct BBa_M31530_sequence 1 tattaacgtttacaatttaaatatttgcttatacaatcttcctgttttatcaaccggggtacatatgattgacatgctagttttacgattaccgttcatcgattctcttgtttgctccagactctcaggcaatgacctgatagcctttgtagacctctcaaaaatagctaccctctccggcatgaatttatcagctagaacggttgaatatcatattgatggtgatttgactgtctccggcctttctcacccttttgaatctttacctacacattactcaggcattgcatttaaaatatatgagggttctaaaaatttttatccttgcgttgaaataaaggcttctcccgcaaaagtattacagggtcataatgtttttggtacaaccgatttagctttatgctctgaggctttattgcttaattttgctaattctttgccttgcctgtatgatttattggatgttaacgctactactattagtagaattgatgccaccttttcagctcgcgccccaaatgaaaatatagctaaacaggttattgaccatttgcgaaatgtatctaatggtcaaactaaatctactcgttcgcagaattgggaatcaactgttacatggaatgaaacttccagacaccgtactttagttgcatatttaaaacatgttgagctacagcaccagattcagcaattaagctctaagccatccgcaaaaatgacctcttatcaaaaggagcaattaaaggtactctctaatcctgacctgttggagtttgcttccggtctggttcgctttgaagctcgaattaaaacgcgatatttgaagtctttcgggcttcctcttaatctttttgatgcaatccgctttgcttctgactataatagtcagggtaaagacctgatttttgatttatggtcattctcgttttctgaactgtttaaagcatttgagggggattcaatgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataatctttttgatgcaatccgctttgcttctgactataatagtcagggtaaatttgagggggattcaatgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataaccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggtacataaggtaattcacaatgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgttccggctaagtaagttccggctaagtaacatggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcaaagatgatcgctgggggtcaaagatgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcatgaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtctaatggaaacttcctcatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctgaaattcacctcgaaagcaagctgataaaccgatacaattaaaggctccttttggagattttcaacgtgaaaaaattattattcgcaattcctttagttgttcctttctattctcactccgctgaaactgttgaaagttgtttagcaaaaccccatacagaaaattcatttactaacgtctggaaagacgacaaaactttagatcgttacgctaactatgagggttgtctgtggaatgctacaggcgttgtagtttgtactggtgacgaaactcagtgttacggtacatgggttcctattgggcttgctatccctgaaaatgagggtggtggctctgagggtggcggttctgagggtggcggttctgagggtggcggtactaaacctcctgagtacggtgatacacctattccgggctatacttatatcaaccctctcgacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatccttctcttgaggagtctcagcctcttaatactttcatgtttcagaataataggttccgaaataggcagggggcattaactgtttatacgggcactgttactcaaggcactgaccccgttaaaacttattaccagtacactcctgtatcatcaaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctttccattctggctttaatgaggatccattcgtttgtgaatatcaaggccaatcgtctgacctgcctcaacctcctgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttccggtgattttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctctaattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaatatttaccttccctccctcaatcggttgaatgtcgcccttttgtctttagcgctggtaaaccatatgaattttctattgattgtgacaaaataaacttattccgtggtgtctttgcgtttcttttatatgttgccacctttatgtatgtattttctacgtttgctaacatactgcgtaataaggagtcttaa BBa_M13008_sequence 1 atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga BBa_M13005_sequence 1 atgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgttccggctaagtaa BBa_M13508_sequence 1 taatggaaacttcctc BBa_M13505_sequence 1 cataaggtaattcaca BBa_M13509_sequence 1 tcgctgggggtcaaag BBa_M13110_sequence 1 tctttttgatgcaatccgctttgcttctgactataatagtcagggtaa BBa_M13102_sequence 1 tattaacgtttacaatttaaatatttgcttatacaatcttcctgtttt BBa_M13003_sequence 1 gtgaaaaaattattattcgcaattcctttagttgttcctttctattctcactccgctgaaactgttgaaagttgtttagcaaaaccccatacagaaaattcatttactaacgtctggaaagacgacaaaactttagatcgttacgctaactatgagggttgtctgtggaatgctacaggcgttgtagtttgtactggtgacgaaactcagtgttacggtacatgggttcctattgggcttgctatccctgaaaatgagggtggtggctctgagggtggcggttctgagggtggcggttctgagggtggcggtactaaacctcctgagtacggtgatacacctattccgggctatacttatatcaaccctctcgacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatccttctcttgaggagtctcagcctcttaatactttcatgtttcagaataataggttccgaaataggcagggggcattaactgtttatacgggcactgttactcaaggcactgaccccgttaaaacttattaccagtacactcctgtatcatcaaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctttccattctggctttaatgaggatccattcgtttgtgaatatcaaggccaatcgtctgacctgcctcaacctcctgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttccggtgattttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctctaattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaatatttaccttccctccctcaatcggttgaatgtcgcccttttgtctttagcgctggtaaaccatatgaattttctattgattgtgacaaaataaacttattccgtggtgtctttgcgtttcttttatatgttgccacctttatgtatgtattttctacgtttgctaacatactgcgtaataaggagtcttaa BBa_M13010_sequence 1 atgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z