BBa_M31532 1 BBa_M31532 This is gene X of M13K07 (Promoter, RBS, and ORF) 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z Though the gene and its regulatory sequences exist in nature in M13K07, they do not yet exist in this separate form. When designing a phage, it is much more practical and effective to think of DNA in functional units than strings of regulatory and coding regions. This part combines the transcriptional and translational regions with the ORF to form a functional (where function is defined as the output of the gene). false false _102_ 0 1380 102 Not in stock false When removed from its place in the genome that has been determined by evolution, we can't be sure the change will be tolerated. There may be cross-talk between copied and separated elements with significant homology. Because we have removed and maintained entire portions of genes in the formation of separate genomic entities, there is also the possibility of expression of these 'partial' genes. I will address this by placing transcriptional terminators and hair pins between genes. false Matt Gethers component1917904 1 BBa_M13010 component1917903 1 BBa_M13510 component1917902 1 BBa_M13110 annotation1917904 1 BBa_M13010 range1917904 1 65 400 annotation1917902 1 BBa_M13110 range1917902 1 1 48 annotation1917903 1 BBa_M13510 range1917903 1 49 64 BBa_M13110 1 BBa_M13110 M13110 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 381-428 in M13K07. It directs transcription of M13 gene X (BBa_M13510, BBa_M13010). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13510 1 BBa_M13510 M13KO7 gene X RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene X message (BBa_M13010). The part aligns with base pairs 480-495 in M13K07 genome. It was identified as the RBS for gene II message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13010 1 BBa_M13010 M13K07 gene X 2006-12-05T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is important for phage maturation. The protein remains in the host cytoplasm to interact with the product of gI and the OM pore (product of gIV) through which the phage ssDNA is threaded as the phage matures. GeneX protein is identical to the C-terminal portion of the gIprotein since gXprotien is normally encoded through an internal initiation of translation from the gI transcript. false true _45_ 0 314 1 Not in stock false need to unstuff from inside gI false Natalie Kuldell BBa_M31532_sequence 1 tctttttgatgcaatccgctttgcttctgactataatagtcagggtaaatttgagggggattcaatgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataa BBa_M13110_sequence 1 tctttttgatgcaatccgctttgcttctgactataatagtcagggtaa BBa_M13510_sequence 1 atttgagggggattca BBa_M13010_sequence 1 atgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z