BBa_M13505 1 BBa_M13505 M13KO7 gene V RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene V message (BBa_M13005). The part aligns with base pairs 827-842 in M13K07 genome. It was identified as the RBS for the gene V message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13105 1 BBa_M13105 M13K07 gene V promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 786-835 in M13K07. It directs transcription of M13 gene V (BBa_M13505, BBa_M13005). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M31533 1 BBa_M31533 This is gene V of M13K07 (Promoter, RBS, and ORF) 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z Though the gene and its regulatory sequences exist in nature in M13K07, they do not yet exist in this separate form. When designing a phage, it is much more practical and effective to think of DNA in functional units than strings of regulatory and coding regions. This part combines the transcriptional and translational regions with the ORF to form a functional (where function is defined as the output of the gene). false false _102_ 0 1380 102 Not in stock false When removed from its place in the genome that has been determined by evolution, we can't be sure the change will be tolerated. There may be cross-talk between copied and separated elements with significant homology. Because we have removed and maintained entire portions of genes in the formation of separate genomic entities, there is also the possibility of expression of these 'partial' genes. I will address this by placing transcriptional terminators and hair pins between genes. false Matt Gethers component1917913 1 BBa_M13505 component1917912 1 BBa_M13105 component1917914 1 BBa_M13005 annotation1917913 1 BBa_M13505 range1917913 1 51 66 annotation1917914 1 BBa_M13005 range1917914 1 67 330 annotation1917912 1 BBa_M13105 range1917912 1 1 50 BBa_M13005 1 BBa_M13005 M13K07 gene V 2006-12-11T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a single stranded DNA binding protein that is important for phage maturation. false false _45_ 0 314 1 Not in stock false RBS for gene V overlaps stop codon for upstream phage genes II and X. false Natalie Kuldell BBa_M13005_sequence 1 atgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgttccggctaagtaa BBa_M31533_sequence 1 ccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggtacataaggtaattcacaatgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgttccggctaagtaa BBa_M13105_sequence 1 ccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggta BBa_M13505_sequence 1 cataaggtaattcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z