BBa_M13507 1 BBa_M13507 M13KO7 gene VII RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene VII message (BBa_M13007). The part aligns with base pairs 1092-1107 in M13K07 genome. It was identified as the RBS for gene VII message by Wezenbeek et al in Gene (1980) 11: 129-148 false true _45_ 0 314 1 Not in stock false New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban false Natalie Kuldell BBa_M31534 1 BBa_M31534 This is gene VII of M13K07 (RBS, and ORF) 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z Though the gene and its regulatory sequences exist in nature in M13K07, they do not yet exist in this separate form. When designing a phage, it is much more practical and effective to think of DNA in functional units than strings of regulatory and coding regions. This part combines the transcriptional and translational regions with the ORF to form a functional (where function is defined as the output of the gene). false false _102_ 0 1380 102 Not in stock false When removed from its place in the genome that has been determined by evolution, we can't be sure the change will be tolerated. There may be cross-talk between copied and separated elements with significant homology. Because we have removed and maintained entire portions of genes in the formation of separate genomic entities, there is also the possibility of expression of these 'partial' genes. I will address this by placing transcriptional terminators and hair pins between genes. false Matt Gethers component1917916 1 BBa_M13007 component1917915 1 BBa_M13507 annotation1917915 1 BBa_M13507 range1917915 1 1 16 annotation1917916 1 BBa_M13007 range1917916 1 23 124 BBa_M13007 1 BBa_M13007 M13K07 gene VII 2006-12-11T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is presented with p9 to initiate phage assembly at the blunt end of the phage coat. Approximately 5 copies of each protein are presented on mature phage. Without p9 or p7, no phage is produced. p7 is one of the smallest ribosomally translated proteins with described function. It is hydrophobic and the N-terminus is negatively charged, suggesting a C-terminus inside orientation. false true _45_ 0 314 1 Not in stock false stop codon overlaps with p9 start codon in M13 genome. false Natalie Kuldell BBa_M13007_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcaaagatga BBa_M13507_sequence 1 gttccggctaagtaac BBa_M31534_sequence 1 gttccggctaagtaactactagatggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcaaagatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z