BBa_M13103 1 BBa_M13103 M13K07 gene III promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 1500-1547 in M13K07. It directs transcription of M13 gene III (BBa_M13503, BBa_M13003). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13003 1 BBa_M13003 M13K07 gene III 2006-12-13T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome, encoding a minor coat protein. Approximately 5 copies of p3 are presented with 5 copies of p6 on the rounded end of the mature phage. In the absence of p3, the phage remains tethered to the bacterial host, elongating to 10 or 20 times the normal phage length and incorporating multiple ssDNA genomes within the coat. p3 (domain II) is also responsible for the initial interaction of the phage with the bacterial pili during infection. Peptide fusions, sometimes large, can be displayed on N-terminal end of p3, though highly charged fusions are difficult to isolate since they are not easily secreted by the host secretion apparatus. The p3 protein is first synthesized as a longer precursor protein that is 18 amino acids longer than the mature protein. The gene's translation initiates with a GTG codon, and changing this codon to an ATG increases expression of gene III to levels with negative effects on phage maturation. false false _45_ 0 314 1 Not in stock false The RBS for gene III is within the transcription termination sequence of the upstream gVIII, thus modifications to termination affect gIII initiation. Translation initiates with a GTG rather than a canonical ATG. There is a unique, natural BamHI site in domain II that may be useful for cloning, though it may prevent interaction of p3 with pilus. false Natalie Kuldell BBa_M31537 1 BBa_M31537 This is gene III of M13K07 (Promoter, RBS, and ORF) 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z Though the gene and its regulatory sequences exist in nature in M13K07, they do not yet exist in this separate form. When designing a phage, it is much more practical and effective to think of DNA in functional units than strings of regulatory and coding regions. This part combines the transcriptional and translational regions with the ORF to form a functional (where function is defined as the output of the gene). false false _102_ 0 1380 102 Not in stock false When removed from its place in the genome that has been determined by evolution, we can't be sure the change will be tolerated. There may be cross-talk between copied and separated elements with significant homology. Because we have removed and maintained entire portions of genes in the formation of separate genomic entities, there is also the possibility of expression of these 'partial' genes. I will address this by placing transcriptional terminators and hair pins between genes. false Matt Gethers component1917940 1 BBa_M13003 component1917939 1 BBa_M13503 component1917938 1 BBa_M13103 annotation1917940 1 BBa_M13003 range1917940 1 65 1339 annotation1917938 1 BBa_M13103 range1917938 1 1 48 annotation1917939 1 BBa_M13503 range1917939 1 49 64 BBa_M13503 1 BBa_M13503 M13K07 gene III RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene III message (BBa_M13003). The part aligns with base pairs 1563-1578 in M13K07 genome. It was identified as the RBS for gene III message by Wezenbeek et al in Gene (1980) 11: 129-148 New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13503_sequence 1 tttggagattttcaac BBa_M31537_sequence 1 aattcacctcgaaagcaagctgataaaccgatacaattaaaggctccttttggagattttcaacgtgaaaaaattattattcgcaattcctttagttgttcctttctattctcactccgctgaaactgttgaaagttgtttagcaaaaccccatacagaaaattcatttactaacgtctggaaagacgacaaaactttagatcgttacgctaactatgagggttgtctgtggaatgctacaggcgttgtagtttgtactggtgacgaaactcagtgttacggtacatgggttcctattgggcttgctatccctgaaaatgagggtggtggctctgagggtggcggttctgagggtggcggttctgagggtggcggtactaaacctcctgagtacggtgatacacctattccgggctatacttatatcaaccctctcgacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatccttctcttgaggagtctcagcctcttaatactttcatgtttcagaataataggttccgaaataggcagggggcattaactgtttatacgggcactgttactcaaggcactgaccccgttaaaacttattaccagtacactcctgtatcatcaaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctttccattctggctttaatgaggatccattcgtttgtgaatatcaaggccaatcgtctgacctgcctcaacctcctgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttccggtgattttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctctaattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaatatttaccttccctccctcaatcggttgaatgtcgcccttttgtctttagcgctggtaaaccatatgaattttctattgattgtgacaaaataaacttattccgtggtgtctttgcgtttcttttatatgttgccacctttatgtatgtattttctacgtttgctaacatactgcgtaataaggagtcttaa BBa_M13103_sequence 1 aattcacctcgaaagcaagctgataaaccgatacaattaaaggctcct BBa_M13003_sequence 1 gtgaaaaaattattattcgcaattcctttagttgttcctttctattctcactccgctgaaactgttgaaagttgtttagcaaaaccccatacagaaaattcatttactaacgtctggaaagacgacaaaactttagatcgttacgctaactatgagggttgtctgtggaatgctacaggcgttgtagtttgtactggtgacgaaactcagtgttacggtacatgggttcctattgggcttgctatccctgaaaatgagggtggtggctctgagggtggcggttctgagggtggcggttctgagggtggcggtactaaacctcctgagtacggtgatacacctattccgggctatacttatatcaaccctctcgacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatccttctcttgaggagtctcagcctcttaatactttcatgtttcagaataataggttccgaaataggcagggggcattaactgtttatacgggcactgttactcaaggcactgaccccgttaaaacttattaccagtacactcctgtatcatcaaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctttccattctggctttaatgaggatccattcgtttgtgaatatcaaggccaatcgtctgacctgcctcaacctcctgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttccggtgattttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctctaattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaatatttaccttccctccctcaatcggttgaatgtcgcccttttgtctttagcgctggtaaaccatatgaattttctattgattgtgacaaaataaacttattccgtggtgtctttgcgtttcttttatatgttgccacctttatgtatgtattttctacgtttgctaacatactgcgtaataaggagtcttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z