BBa_M31744 1 BBa_M31744 Gene X w/o Promoter for Gene V 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 Gene X This part produces the GEne X protein but does not contain a promoter for Gene V. false false _102_ 0 1374 102 Not in stock false I actually didn't have to remove the RBS for Gene V since it is in a space between Genes X and V. I only removed the Gene V promoter. false Emilienne Repak annotation1917246 1 partial ex-Gene V Promoter range1917246 1 291 336 BBa_M31744_sequence 1 atgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccagcgtccagattggtataacgagcccgttctcaaaattgcatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z