BBa_M31746 1 BBa_M31746 Gene V w/o RBS for Gene VII 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 Gene V This produces Protein V and still has Gene VII promoter (if one exists) intact. It does not have a Gene VII RBS. false false _102_ 0 1374 102 Not in stock false I could not destroy the Gene VII promoter even though this would be ideal for refactoring. This promoter has not been identified, but I suspect that, if it exists, it sits somewhere in this gene. false Emilienne Repak annotation1917256 1 ex-Gene VII RBS range1917256 1 250 264 BBa_M31746_sequence 1 atgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgtcccagccaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z