BBa_M31748 1 BBa_M31748 Gene VII w/o Genes IX RBS or VIII Promoter 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 Gene VII This produces Protein VII but does not contain the promoter region for Genes VIII or RBS for Gene IX. It may contain a Gene IX promoter. false false _102_ 0 1374 102 Not in stock false I realized that the Gene VIII promoter is actually within this gene, which surprised me, and I had to remove that along with the RBS for Gene IX. I suspect that the Gene IX promoter, should one exist, may be in this gene. false Emilienne Repak annotation1917351 1 ex-Gene VIII promoter range1917351 1 48 94 annotation1917397 1 ex-Gene IX RBS range1917397 1 83 98 BBa_M31748_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatatctgtcgtgctctgcttcgcactcggtattatcgccggtgggcagagatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z