BBa_M31780 1 BBa_M31780 Gene IX w/o Gene VIII RBS 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 Gene IX This produces Protein IX but does not contain the Gene VIII RBS. false false _102_ 0 1374 102 Not in stock false I needed to remove the Gene VIII RBS. false Emilienne Repak annotation1917470 1 ex-Gene VIII RBS range1917470 1 80 95 BBa_M31780_sequence 1 atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttgatggagacatcttcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z