BBa_M31782 1 BBa_M31782 Gene VIII w/o Gene III Promoter 2007-02-28T12:00:00Z 2015-05-08T01:14:00Z M13K07 Gene VIII This produces the Gene VIII protein but does not have the Gene III Promoter. false false _102_ 0 1374 102 Not in stock false I had to remove the Gene III Promoter, but the Gene III RBS site is between Genes VIII and III, so I didn't have to worry about that. false Emilienne Repak annotation1917480 1 ex-Gene III Promoter range1917480 1 200 222 BBa_M31782_sequence 1 atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaatttacatccaaggctagttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z