BBa_M31901 1 BBa_M31901 HpaI to BamHI section of M13K07 genome 2007-02-27T12:00:00Z 2015-05-08T01:14:00Z The M13K07 Genome. HpaI to BamHI section of M13K07 genome false false _102_ 0 1371 102 Not in stock false k false aditya kohli annotation1916249 1 BBa_M13102 range1916249 1 1 48 BBa_M31901_sequence 1 tattaacgtttacaatttaaatatttgcttatacaatcttcctgtttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z