BBa_M31960 1 BBa_M31960 Gene VII of M13K07 modified 2007-02-27T12:00:00Z 2015-05-08T01:14:01Z sequence/modified Modified to reduce repeats, same AA's present false false _102_ 0 1381 102 Not in stock false none false Rebecca Adams BBa_M31960_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatttcagtcgtgctttgctttgcgctcggtatcattgctggaggacagagatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z