BBa_M31980 1 BBa_M31980 gene 7 from M13K07 modified 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z M13K07 genome gene 7 from M13K07 modified to remove rbs 9 and promoter of gene 8. false false _102_ 0 1373 102 Not in stock false n/a false Tiffany Guo BBa_M13509 1 BBa_M13509 M13Ko7 gene IX RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene IX message (BBa_M13009). The part aligns with base pairs 1190-1205 in M13K07 genome. It was identified as the RBS for gene IX message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M31986 1 EagI EagI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none EagI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M31976 1 BBa_M31976 MfeI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none MfeI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M13503 1 BBa_M13503 M13K07 gene III RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene III message (BBa_M13003). The part aligns with base pairs 1563-1578 in M13K07 genome. It was identified as the RBS for gene III message by Wezenbeek et al in Gene (1980) 11: 129-148 New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13010 1 BBa_M13010 M13K07 gene X 2006-12-05T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is important for phage maturation. The protein remains in the host cytoplasm to interact with the product of gI and the OM pore (product of gIV) through which the phage ssDNA is threaded as the phage matures. GeneX protein is identical to the C-terminal portion of the gIprotein since gXprotien is normally encoded through an internal initiation of translation from the gI transcript. false true _45_ 0 314 1 Not in stock false need to unstuff from inside gI false Natalie Kuldell BBa_M31978 1 BBa_M31978 gene 9 from M13K07 modified 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z M13K07 genome gene 9 from M13K07 modified to remove rbs 8. false false _102_ 0 1373 102 Not in stock false n/a false Tiffany Guo BBa_M31997 1 Acc651 Acc65I restriction enzyme site 2007-02-27T12:00:00Z 2015-05-08T01:14:01Z An E. coli strain that carries the cloned Acc65I gene from Acinetobacter calcoaceticus 65 Acc65I restriction enzyme site false true _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M13103 1 BBa_M13103 M13K07 gene III promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 1500-1547 in M13K07. It directs transcription of M13 gene III (BBa_M13503, BBa_M13003). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M31991 1 XbaI XbaI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none XbaI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M13105 1 BBa_M13105 M13K07 gene V promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 786-835 in M13K07. It directs transcription of M13 gene V (BBa_M13505, BBa_M13005). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M31992 1 SpeI SpeI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none SpeI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M31987 1 BclI BclI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none BclI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M31983 1 EcoRI EcoRI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none EcoRI restriction enzyme site false true _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M13003 1 BBa_M13003 M13K07 gene III 2006-12-13T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome, encoding a minor coat protein. Approximately 5 copies of p3 are presented with 5 copies of p6 on the rounded end of the mature phage. In the absence of p3, the phage remains tethered to the bacterial host, elongating to 10 or 20 times the normal phage length and incorporating multiple ssDNA genomes within the coat. p3 (domain II) is also responsible for the initial interaction of the phage with the bacterial pili during infection. Peptide fusions, sometimes large, can be displayed on N-terminal end of p3, though highly charged fusions are difficult to isolate since they are not easily secreted by the host secretion apparatus. The p3 protein is first synthesized as a longer precursor protein that is 18 amino acids longer than the mature protein. The gene's translation initiates with a GTG codon, and changing this codon to an ATG increases expression of gene III to levels with negative effects on phage maturation. false false _45_ 0 314 1 Not in stock false The RBS for gene III is within the transcription termination sequence of the upstream gVIII, thus modifications to termination affect gIII initiation. Translation initiates with a GTG rather than a canonical ATG. There is a unique, natural BamHI site in domain II that may be useful for cloning, though it may prevent interaction of p3 with pilus. false Natalie Kuldell BBa_M31985 1 BglII BglII restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none BglII restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M31975 1 BBa_M31975 M13 refactoring 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z parts from M13K07 genome M13K07 refactored to elimiate overlaps and add restriction enzyme sites inbetween parts. false false _102_ 0 1373 102 Not in stock false 1) eliminate rbs and promoters within genes: took into consideration codon changes that would not change amino acid sequences but would decrease the strength of the rbs or promoter. 2) add restriction sites between each part: tried to keep sticky ends as consistent as possible (i.e. after every promoter, the restriction site sticky end is 3'ctag), however, there aren't enough zero cutting isoschizomers. false Tiffany Guo component1917529 1 BBa_M13008 component1917506 1 BBa_M31994 component1917508 1 BBa_M31990 component1917503 1 BBa_M13002 component1917535 1 BBa_M13503 component1917527 1 BBa_M13508 component1917515 1 BBa_M31981 component1917511 1 BBa_M13105 component1917512 1 BBa_M31992 component1917520 1 BBa_M31987 component1917518 1 BBa_M31988 component1917516 1 BBa_M31995 component1917514 1 BBa_M31989 component1917504 1 BBa_M31997 component1917521 1 BBa_M13509 component1917517 1 BBa_M13507 component1917533 1 BBa_M13103 component1917534 1 BBa_M31991 component1917509 1 BBa_M13010 component1917510 1 BBa_M31996 component1917536 1 BBa_M31982 component1917519 1 BBa_M31980 component1917530 1 BBa_M31983 component1917525 1 BBa_M13108 component1917531 1 BBa_M31977 component1917532 1 BBa_M31976 component1917524 1 BBa_M31985 component1917507 1 BBa_M13510 component1917523 1 BBa_M31978 component1917513 1 BBa_M13505 component1917528 1 BBa_M31984 component1917526 1 BBa_M31993 component1917505 1 BBa_M13110 component1917522 1 BBa_M31986 component1917537 1 BBa_M13003 annotation1917531 1 BBa_M31977 range1917531 1 2568 2601 annotation1917525 1 BBa_M13108 range1917525 1 2265 2311 annotation1917508 1 BBa_M31990 range1917508 1 1310 1317 annotation1917520 1 BBa_M31987 range1917520 1 2132 2137 annotation1917518 1 BBa_M31988 range1917518 1 2024 2029 annotation1917534 1 BBa_M31991 range1917534 1 2656 2661 annotation1917536 1 BBa_M31982 range1917536 1 2678 2685 annotation1917535 1 BBa_M13503 range1917535 1 2662 2677 annotation1917526 1 BBa_M31993 range1917526 1 2312 2317 annotation1917529 1 BBa_M13008 range1917529 1 2340 2561 annotation1917522 1 BBa_M31986 range1917522 1 2154 2159 annotation1917521 1 BBa_M13509 range1917521 1 2138 2153 annotation1917523 1 BBa_M31978 range1917523 1 2160 2258 annotation1917510 1 BBa_M31996 range1917510 1 1654 1659 annotation1917505 1 BBa_M13110 range1917505 1 1240 1287 annotation1917532 1 BBa_M31976 range1917532 1 2602 2607 annotation1917503 1 BBa_M13002 range1917503 1 1 1233 annotation1917512 1 BBa_M31992 range1917512 1 1710 1715 annotation1917524 1 BBa_M31985 range1917524 1 2259 2264 annotation1917519 1 BBa_M31980 range1917519 1 2030 2131 annotation1917509 1 BBa_M13010 range1917509 1 1318 1653 annotation1917507 1 BBa_M13510 range1917507 1 1294 1309 annotation1917511 1 BBa_M13105 range1917511 1 1660 1709 annotation1917504 1 BBa_M31997 range1917504 1 1234 1239 annotation1917513 1 BBa_M13505 range1917513 1 1716 1731 annotation1917533 1 BBa_M13103 range1917533 1 2608 2655 annotation1917530 1 BBa_M31983 range1917530 1 2562 2567 annotation1917506 1 BBa_M31994 range1917506 1 1288 1293 annotation1917537 1 BBa_M13003 range1917537 1 2686 3960 annotation1917515 1 BBa_M31981 range1917515 1 1738 2001 annotation1917517 1 BBa_M13507 range1917517 1 2008 2023 annotation1917527 1 BBa_M13508 range1917527 1 2318 2333 annotation1917528 1 BBa_M31984 range1917528 1 2334 2339 annotation1917514 1 BBa_M31989 range1917514 1 1732 1737 annotation1917516 1 BBa_M31995 range1917516 1 2002 2007 BBa_M31990 1 AscI AscI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none AscI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M31994 1 AvrII AvrII restriction enzyme site 2007-02-27T12:00:00Z 2015-05-08T01:14:01Z A E. coli strain that carries the AvrII gene from Anabaena variabilis UW (E. Rosenvold). AvrII restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M31977 1 BBa_M31977 transcription terminator 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z M13K07 genome transcription terminator (hairpin) false false _102_ 0 1373 102 Not in stock false n/a false Tiffany Guo BBa_M13505 1 BBa_M13505 M13KO7 gene V RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene V message (BBa_M13005). The part aligns with base pairs 827-842 in M13K07 genome. It was identified as the RBS for the gene V message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13507 1 BBa_M13507 M13KO7 gene VII RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene VII message (BBa_M13007). The part aligns with base pairs 1092-1107 in M13K07 genome. It was identified as the RBS for gene VII message by Wezenbeek et al in Gene (1980) 11: 129-148 false true _45_ 0 314 1 Not in stock false New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban false Natalie Kuldell BBa_M31989 1 BssHII BssHII restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none BssHII restriction enzyme site false true _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M31981 1 BBa_M31981 M13K07 gene 5 modified 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z M13K07 genome Modified to remove rbs 7 and restriction site for BsrGI. false false _102_ 0 1373 102 Not in stock false keep amino acids the same, change codons. false Tiffany Guo BBa_M13110 1 BBa_M13110 M13110 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 381-428 in M13K07. It directs transcription of M13 gene X (BBa_M13510, BBa_M13010). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M31996 1 BsiWI BsiWI restriction enzyme site 2007-02-27T12:00:00Z 2015-05-08T01:14:01Z A E. coli strain that carries the BsiWI gene from Bacillus species (D. Clark). BsiWI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M13510 1 BBa_M13510 M13KO7 gene X RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene X message (BBa_M13010). The part aligns with base pairs 480-495 in M13K07 genome. It was identified as the RBS for gene II message by Wezenbeek et al in Gene (1980) 11: 129-148 false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13508 1 BBa_M13508 M13K07 gene VIII RBS 2006-12-14T12:00:00Z 2015-05-08T01:13:56Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban This RBS is part of the bacteriophage M13 genome, initiating translation of the gene VIII message (BBa_M13008). The part aligns with base pairs 1285-1300 in M13K07 genome. It was identified as the RBS for gene VIII message by Wezenbeek et al in Gene (1980) 11: 129-148 false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M31993 1 NheI NheI restriction enzyme site 2007-02-27T12:00:00Z 2015-05-08T01:14:01Z A E. coli strain that carries the NheI gene from Neisseria mucosa heidelbergensis (ATCC 25999). NheI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M31988 1 MluI MluI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none MluI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M13002 1 BBa_M13002 M13K07 gene II 2006-12-13T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is important for phage DNA replication, initiating ssDNA synthesis of the (+) strand by nicking the RF near the M13 replication origin. p10 is encoded within gII thanks to a translation re-initiation event. false false _45_ 0 314 1 Not in stock false need to unstuff gX from within coding sequence. RBS for downstream gV overlaps the gII stop codon. false Natalie Kuldell BBa_M31995 1 BsrG1 BsrGI restriction enzyme site 2007-02-27T12:00:00Z 2015-05-08T01:14:01Z Bacillus stearothermophilus GR75 (Z. Chen) BsrGI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M13008 1 BBa_M13008 M13KO7 gene VIII 2006-12-12T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes the major coat protein, with approximately 2700 copies of the protein on each phage particle. The protein is first synthesized at a longer precursor protein that is clipped between the Alanines at positions 23 and 24. It is possible to silently add a Pst site to clone fusions upstream and in frame with Ala that begins mature protein. Small peptide-fusions are possible to the N-terminal portion of the mature p8 (phage display systems are built around this finding) but addition of more than 6 or 8 residues makes the phage pack poorly, leading to unproductive infections. false true _45_ 0 314 1 In stock false Many! The start codon for gene 8 overlaps with the stop codon for the upstream gene 9. Might be nice to include cloning sites for directed N-terminal fusions to mature form of protein. Might be nice to codon vary a different biobrick of gene VIII to allow for two genes expressed on single genome, inhibiting recombination in ssDNA. false Natalie Kuldell BBa_M13108 1 BBa_M13108 M13K07 gene VIII promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 1155-1201 in M13K07. It directs transcription of M13 gene VIII (BBa_M13508, BBa_M13008). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false true _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M31982 1 NotI NotI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none NotI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M31984 1 PspOMI PspOMI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none PspOMI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_M13108_sequence 1 aatctccgttgtactttgtttcgcgcttggtataatcgctgggggtc BBa_M13507_sequence 1 gttccggctaagtaac BBa_M31985_sequence 1 agatct BBa_M31990_sequence 1 ggcgcgcc BBa_M31981_sequence 1 atgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtataccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgttccagctaactaa BBa_M31986_sequence 1 cggccg BBa_M13510_sequence 1 atttgagggggattca BBa_M31983_sequence 1 gaattc BBa_M13103_sequence 1 aattcacctcgaaagcaagctgataaaccgatacaattaaaggctcct BBa_M13008_sequence 1 atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga BBa_M31997_sequence 1 ggtacc BBa_M31984_sequence 1 gggccc BBa_M31993_sequence 1 gctagc BBa_M13509_sequence 1 tcgctgggggtcaaag BBa_M13110_sequence 1 tctttttgatgcaatccgctttgcttctgactataatagtcagggtaa BBa_M31980_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgtagtactgtgtttcgcgctgggcattatcgctgggggccaaagatga BBa_M13010_sequence 1 atgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataa BBa_M31991_sequence 1 tctaga BBa_M31988_sequence 1 acgcgt BBa_M31995_sequence 1 tgtaca BBa_M13503_sequence 1 tttggagattttcaac BBa_M31996_sequence 1 cgtacg BBa_M13105_sequence 1 ccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggta BBa_M31982_sequence 1 gcggccgc BBa_M31994_sequence 1 cctagg BBa_M13002_sequence 1 atgattgacatgctagttttacgattaccgttcatcgattctcttgtttgctccagactctcaggcaatgacctgatagcctttgtagacctctcaaaaatagctaccctctccggcatgaatttatcagctagaacggttgaatatcatattgatggtgatttgactgtctccggcctttctcacccttttgaatctttacctacacattactcaggcattgcatttaaaatatatgagggttctaaaaatttttatccttgcgttgaaataaaggcttctcccgcaaaagtattacagggtcataatgtttttggtacaaccgatttagctttatgctctgaggctttattgcttaattttgctaattctttgccttgcctgtatgatttattggatgttaacgctactactattagtagaattgatgccaccttttcagctcgcgccccaaatgaaaatatagctaaacaggttattgaccatttgcgaaatgtatctaatggtcaaactaaatctactcgttcgcagaattgggaatcaactgttacatggaatgaaacttccagacaccgtactttagttgcatatttaaaacatgttgagctacagcaccagattcagcaattaagctctaagccatccgcaaaaatgacctcttatcaaaaggagcaattaaaggtactctctaatcctgacctgttggagtttgcttccggtctggttcgctttgaagctcgaattaaaacgcgatatttgaagtctttcgggcttcctcttaatctttttgatgcaatccgctttgcttctgactataatagtcagggtaaagacctgatttttgatttatggtcattctcgttttctgaactgtttaaagcatttgagggggattcaatgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataa BBa_M31977_sequence 1 tacaattaaaggctccttttggagcctttttttt BBa_M13508_sequence 1 taatggaaacttcctc BBa_M31987_sequence 1 tgatca BBa_M31989_sequence 1 gcgcgc BBa_M13505_sequence 1 cataaggtaattcaca BBa_M31975_sequence 1 atgattgacatgctagttttacgattaccgttcatcgattctcttgtttgctccagactctcaggcaatgacctgatagcctttgtagacctctcaaaaatagctaccctctccggcatgaatttatcagctagaacggttgaatatcatattgatggtgatttgactgtctccggcctttctcacccttttgaatctttacctacacattactcaggcattgcatttaaaatatatgagggttctaaaaatttttatccttgcgttgaaataaaggcttctcccgcaaaagtattacagggtcataatgtttttggtacaaccgatttagctttatgctctgaggctttattgcttaattttgctaattctttgccttgcctgtatgatttattggatgttaacgctactactattagtagaattgatgccaccttttcagctcgcgccccaaatgaaaatatagctaaacaggttattgaccatttgcgaaatgtatctaatggtcaaactaaatctactcgttcgcagaattgggaatcaactgttacatggaatgaaacttccagacaccgtactttagttgcatatttaaaacatgttgagctacagcaccagattcagcaattaagctctaagccatccgcaaaaatgacctcttatcaaaaggagcaattaaaggtactctctaatcctgacctgttggagtttgcttccggtctggttcgctttgaagctcgaattaaaacgcgatatttgaagtctttcgggcttcctcttaatctttttgatgcaatccgctttgcttctgactataatagtcagggtaaagacctgatttttgatttatggtcattctcgttttctgaactgtttaaagcatttgagggggattcaatgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggtacctctttttgatgcaatccgctttgcttctgactataatagtcagggtaacctaggatttgagggggattcaggcgcgccatgaatatttatgacgattccgcagtattggacgctatccagtctaaacattttactattaccccctctggcaaaacttcttttgcaaaagcctctcgctattttggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttactatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtggtattcctaaatctcaactgatgaatctttctacctgtaataatgttgttccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactggtataatgagccagttcttaaaatcgcataacgtacgccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggtaactagtcataaggtaattcacagcgcgcatgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtataccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgttccagctaactaatgtacagttccggctaagtaacacgcgtatggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgtagtactgtgtttcgcgctgggcattatcgctgggggccaaagatgatgatcatcgctgggggtcaaagcggccgatgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcatcatgaagatctaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcgctagctaatggaaacttcctcgggcccatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctgagaattctacaattaaaggctccttttggagccttttttttcaattgaattcacctcgaaagcaagctgataaaccgatacaattaaaggctccttctagatttggagattttcaacgcggccgcgtgaaaaaattattattcgcaattcctttagttgttcctttctattctcactccgctgaaactgttgaaagttgtttagcaaaaccccatacagaaaattcatttactaacgtctggaaagacgacaaaactttagatcgttacgctaactatgagggttgtctgtggaatgctacaggcgttgtagtttgtactggtgacgaaactcagtgttacggtacatgggttcctattgggcttgctatccctgaaaatgagggtggtggctctgagggtggcggttctgagggtggcggttctgagggtggcggtactaaacctcctgagtacggtgatacacctattccgggctatacttatatcaaccctctcgacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatccttctcttgaggagtctcagcctcttaatactttcatgtttcagaataataggttccgaaataggcagggggcattaactgtttatacgggcactgttactcaaggcactgaccccgttaaaacttattaccagtacactcctgtatcatcaaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctttccattctggctttaatgaggatccattcgtttgtgaatatcaaggccaatcgtctgacctgcctcaacctcctgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttccggtgattttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctctaattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaatatttaccttccctccctcaatcggttgaatgtcgcccttttgtctttagcgctggtaaaccatatgaattttctattgattgtgacaaaataaacttattccgtggtgtctttgcgtttcttttatatgttgccacctttatgtatgtattttctacgtttgctaacatactgcgtaataaggagtcttaa BBa_M31976_sequence 1 caattg BBa_M13003_sequence 1 gtgaaaaaattattattcgcaattcctttagttgttcctttctattctcactccgctgaaactgttgaaagttgtttagcaaaaccccatacagaaaattcatttactaacgtctggaaagacgacaaaactttagatcgttacgctaactatgagggttgtctgtggaatgctacaggcgttgtagtttgtactggtgacgaaactcagtgttacggtacatgggttcctattgggcttgctatccctgaaaatgagggtggtggctctgagggtggcggttctgagggtggcggttctgagggtggcggtactaaacctcctgagtacggtgatacacctattccgggctatacttatatcaaccctctcgacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatccttctcttgaggagtctcagcctcttaatactttcatgtttcagaataataggttccgaaataggcagggggcattaactgtttatacgggcactgttactcaaggcactgaccccgttaaaacttattaccagtacactcctgtatcatcaaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctttccattctggctttaatgaggatccattcgtttgtgaatatcaaggccaatcgtctgacctgcctcaacctcctgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttccggtgattttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctctaattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaatatttaccttccctccctcaatcggttgaatgtcgcccttttgtctttagcgctggtaaaccatatgaattttctattgattgtgacaaaataaacttattccgtggtgtctttgcgtttcttttatatgttgccacctttatgtatgtattttctacgtttgctaacatactgcgtaataaggagtcttaa BBa_M31992_sequence 1 actagt BBa_M31978_sequence 1 atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcatcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z