BBa_M31979 1 BBa_M31979 M13K07 gene9 refactored 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z M13K07 genomic sequence. The M13K07 gene 9 was refactored. false false _102_ 0 1386 102 Not in stock false Any overlaps with other genes in the M13K07 genome were eliminated and restriction enzyme sites were added for easier manipulation of the genes, such as insertion and deletion. false Iny Jhun annotation1917259 1 NcoI range1917259 1 1 6 annotation1917260 1 NcoI range1917260 1 122 127 annotation1917270 1 g9-promoter range1917270 1 7 22 annotation1917289 1 g9 range1917289 1 23 121 BBa_M31979_sequence 1 ccatggtcgctgggggtcaaagatgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcgtaaccatgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z