BBa_M33001 1 BBa_M33001 Nar operon promoter (narGp) => PoPs 2010-05-31T11:00:00Z 2015-05-08T01:14:01Z Part was synthesized based on the promoter of the nar operon naturally present in E. coli. The narG promoter is located at the beginning the nar operon and is naturally activated during nitrogen respiration of E. Coli by the Fnr protein to signal reduction of nitrate to nitrite. In the presence of nitrate, Fnr protein binds to a region upstream of narGp to act as an activator. false false _577_ 0 6923 9 Not in stock false Design includes BioBrick suffixes and prefixes, and the promoter sequence itself was checked for restriction digest sites to ensure compliance with Assembly Standard 10. false Daniel Bui and Aaditya Shidham annotation2069943 1 narGp range2069943 1 1 144 BBa_M33001_sequence 1 atcctaaaggggtatcttaggaatttactttatttttcatccccatcactcttgatcgttatcaattcccacgctgtttcagagcgttaccttgcccttaaacattagcaatgtcgatttatcagagggccgacaggctcccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z