BBa_M33002 1 BBa_M33002 CDS for Fnr-LH28 protein, activates narGp in presence of nitrate. 2010-05-31T11:00:00Z 2015-05-08T01:14:01Z The part comes from the E. coli genome. The fnr gene naturally is activated under anaerobic conditions during E. coli nitrogen respiration. The part above contains a single missense LH28 mutation to allow it to operate under aerobic conditions. Cytoplasmic Fnr-LH28 protein created by the gene can bind to a regulatory region upstream of the nar operon as an activator, facilitating the reduction of nitrate to nitrite. false false _577_ 0 6923 9 Not in stock false The coding sequence was checked for restriction enzyme sites to ensure that it is Assembly Standard 10-compliant. false Daniel Bui and Aaditya Shidham annotation2069955 1 fnr-LH28 range2069955 1 1 756 annotation2069958 1 Stop Codon range2069958 1 751 756 annotation2069956 1 Start Codon range2069956 1 1 3 annotation2069957 1 T to A LH28 Mutation range2069957 1 83 83 BBa_M33002_sequence 1 atgatcccggaaaagcgaattatacggcgcattcagtctggcggttgtgctatccattgccaggattgcagcatcagccagcattgcatcccgttcacactcaacgaacatgagcttgatcagcttgataatatcattgagcggaagaagcctattcagaaaggccagacgctgtttaaggctggtgatgaacttaaatcgctttatgccatccgctccggtacgattaaaagttataccatcactgagcaaggcgacgagcaaatcactggtttccatttagcaggcgacctggtgggatttgacgccatcggcagcggccatcacccgagcttcgcgcaggcgctggaaacctcgatggtatgtgaaatcccgttcgaaacgctggacgatttgtccggtaaaatgccgaatctgcgtcagcagatgatgcgtctgatgagcggtgaaatcaaaggcgatcaggacatgatcctgctgttgtcgaagaaaaatgccgaggaacgtctggctgcattcatctacaacctgtcccgtcgttttgcccaacgcggcttctcccctcgtgagttccgcctgacgatgactcgtggcgatatcggtaactatctgggcctgacggtagaaaccatcagccgtctgctgggtcgcttccagaaaagcggcatgctggcagtcaaaggtaaatacatcaccatcgaaaataacgatgcgctggcccagcttgctggtcatacgcgtaacgttgcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z